ACRV1 (NM_020108) Human Untagged Clone
CAT#: SC304700
ACRV1 (untagged)-Human acrosomal vesicle protein 1 (ACRV1), transcript variant 4
CNY 3990.00
货期*
详询
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D11S4365; SP-10; SPACA2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_020108, the custom clone sequence may differ by one or more nucleotides
ATGAACAGGTTTCTCTTGCTAATGAGTCTTTATCTGCTTGGATCTGCCAGAGGAACATCA AGTCAGCCTAATGAGCTTTCTGGCTCCATAGATCATCAAACTTCAGTTCAGCAACTTCCA GGTGAGCAGCCTTCAGGAGAACAGCCTTCAGGTGAACACCTCTCCGGAGAACAGCCTTTG AGTGAGCTTGAGTCAGGTGAACAGCCTTCAGATGAACAGCCTTCAGGTGAACATGGCTCC GGTGAACAGCCTTCTGGTGAGCAGGCCTCGGGTGAACAGCCTTCAGGTGAGCACGCTTCA GGGGAACAGGCTTCAGGTGCACCAATTTCAAGCACATCTACAGGCACAATATTAAATTGC TACACATGTGCTTATATGAATGATCAAGGAAAATGTCTTCGTGGAGAGGGAACCTGCATC ACTCAGAATTCCCAGCAGTGCATGTTAAAGAAGATCTTTGAAGGTGGAAAACTCCAATTC ATGGTTCAAGGGTGTGAGAACATGTGCCCATCTATGAACCTCTTCTCCCATGGAACGAGG ATGCAAATTATATGCTGTCGAAATCAATCTTTCTGCAATAAGATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_020108 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020108.3, NP_064493.1 |
RefSeq Size | 1128 bp |
RefSeq ORF | 588 bp |
Locus ID | 56 |
UniProt ID | P26436 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a testis-specific, differentiation antigen, acrosomal vesicle protein 1, that arises within the acrosomal vesicle during spermatogenesis, and is associated with the acrosomal membranes and matrix of mature sperm. The acrosomal vesicle protein 1 may be involved in sperm-zona binding or penetration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (4) lacks a 210 nt fragment in exon II, which results in 70 aa fewer in isoform d, as compared to isoform a encoded by variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...