OPN1LW (NM_020061) Human Untagged Clone
CAT#: SC304695
OPN1LW (untagged)-Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW)
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CBBM; CBP; COD5; RCP; ROP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_020061 edited
ATAGCCATGGCCCAGCAGTGGAGCCTCCAAAGGCTCGCAGGCCGCCATCCGCAGGACAGC TATGAGGACAGCACCCAGTCCAGCATCTTCACCTACACCAACAGCAACTCCACCAGAGGC CCCTTCGAAGGCCCGAATTACCACATCGCTCCCAGATGGGTGTACCACCTCACCAGTGTC TGGATGATCTTTGTGGTCACTGCATCCGTCTTCACAAATGGGCTTGTGCTGGCGGCCACC ATGAAGTTCAAGAAGCTGCGCCACCCGCTGAACTGGATCCTGGTGAACCTGGCGGTCGCT GACCTAGCAGAGACCGTCATCGCCAGCACTATCAGCATTGTGAACCAGGTCTCTGGCTAC TTCGTGCTGGGCCACCCTATGTGTGTCCTGGAGGGCTACACCGTCTCCCTGTGTGGGATC ACAGGTCTCTGGTCTCTGGCCATCATTTCCTGGGAGAGGTGGCTGGTGGTGTGCAAGCCC TTTGGCAATGTGAGATTTGATGCCAAGCTGGCCATCGTGGGCATTGCCTTCTCCTGGATC TGGTCTGCTGTGTGGACAGCCCCGCCCATCTTTGGTTGGAGCAGGTACTGGCCCCACGGC CTGAAGACTTCATGCGGCCCAGACGTGTTCAGCGGCAGCTCGTACCCCGGGGTGCAGTCT TACATGATTGTCCTCATGGTCACCTGCTGCATCATCCCACTCGCTATCATCATGCTCTGC TACCTCCAAGTGTGGCTGGCCATCCGAGCGGTGGCAAAGCAGCAGAAAGAGTCTGAATCC ACCCAGAAGGCAGAGAAGGAAGTGACGCGCATGGTGGTGGTGATGATCTTTGCGTACTGC GTCTGCTGGGGACCCTACACCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGTTACGCC TTCCACCCTTTGATGGCTGCCCTGCCGGCCTACTTTGCCAAAAGTGCCACTATCTACAAC CCCGTTATCTATGTCTTTATGAACCGGCAGTTTCGAAACTGCATCTTGCAGCTTTTCGGG AAGAAGGTTGACGATGGCTCTGAACTCTCCAGCGCCTCCAAAACGGAGGTCTCATCTGTG TCCTCGGTATCGCCTGCATGA |
Restriction Sites | Please inquire |
ACCN | NM_020061 |
Insert Size | 1100 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020061.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020061.2, NP_064445.1 |
RefSeq Size | 1356 bp |
RefSeq ORF | 1095 bp |
Locus ID | 5956 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes for a light absorbing visual pigment of the opsin gene family. The encoded protein is called red cone photopigment or long-wavelength sensitive opsin. Opsins are G-protein coupled receptors with seven transmembrane domains, an N-terminal extracellular domain, and a C-terminal cytoplasmic domain. This gene and the medium-wavelength opsin gene are tandemly arrayed on the X chromosome and frequent unequal recombination and gene conversion may occur between these sequences. X chromosomes may have fusions of the medium- and long-wavelength opsin genes or may have more than one copy of these genes. Defects in this gene are the cause of partial, protanopic colorblindness. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224868 | OPN1LW (Myc-DDK-tagged)-Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) |
CNY 5488.00 |
|
RC224868L1 | Lenti-ORF clone of OPN1LW (Myc-DDK-tagged)-Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) |
CNY 7888.00 |
|
RC224868L2 | Lenti-ORF clone of OPN1LW (mGFP-tagged)-Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) |
CNY 5890.00 |
|
RC224868L3 | Lenti-ORF clone of OPN1LW (Myc-DDK-tagged)-Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) |
CNY 5890.00 |
|
RC224868L4 | Lenti-ORF clone of OPN1LW (mGFP-tagged)-Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) |
CNY 7888.00 |
|
RG224868 | OPN1LW (tGFP-tagged) - Human opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) |
CNY 4370.00 |