NDFIP2 (NM_019080) Human Untagged Clone
CAT#: SC304668
NDFIP2 (untagged)-Human Nedd4 family interacting protein 2 (NDFIP2), transcript variant 1
CNY 3656.00
CNY 5510.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | N4WBP5A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC304668 representing NM_019080.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCACGCCGGCGGAGCCAGCGAGTCTGCGCGAGCGGTCCGAGCATGCTCAATAGCGCGCGCGGCGCC CCGGAGCTTCTCCGCGGAACCGCGACCAACGCGGAGGTCTCGGCGGCCGCTGCGGGAGCCACAGGAAGT GAAGAGCTTCCGCCGGGAGACCGCGGCTGCAGGAACGGAGGCGGAAGGGGCCCTGCGGCGACGACGTCG TCGACGGGGGTGGCCGTGGGAGCTGAGCACGGAGAAGACTCCCTCTCTCGGAAGCCGGATCCCGAGCCG GGCAGGATGGATCACCACCAGCCGGGGACTGGGCGCTACCAGGTGCTTCTTAATGAAGAGGATAACTCA GAATCATCGGCTATAGAGCAGCCACCTACTTCAAACCCAGCACCGCAGATTGTGCAGGCTGTGTCTTCA GCACCAGCACTTGAAACTGACTCTTCCCCTCCACCATATAGTAGTATTACTGTGGAAGTACCTACAACT TCAGATACAGAAGTTTACGGTGAGTTTTATCCCGTGCCACCTCCCTATAGCGTTGCTACCTCTCTTCCT ACATACGATGAAGCTGAGAAGGCTAAAGCTGCTGCAATGGCAGCTGCAGCAGCAGAAACATCTCAAAGA ATTCAGGAGGAAGAGTGTCCACCAAGAGATGACTTCAGTGATGCAGACCAGCTCAGAGTGGGGAATGAT GGCATTTTCATGCTGGCATTTTTCATGGCATTTATTTTCAACTGGCTTGGATTTTGTTTATCCTTCTGT ATCACCAATACCATAGCTGGAAGGTATGGTGCTATCTGCGGATTTGGCCTTTCCTTGATCAAATGGATC CTTATTGTCAGGTTTTCTGATTATTTTACTGGATATTTCAATGGACAGTATTGGCTTTGGTGGATATTT CTTGTACTTGGCCTGCTCCTTTTCTTCAGAGGATTTGTTAATTATCTAAAAGTCAGAAACATGTCTGAA AGTATGGCAGCTGCTCATAGAACAAGGTATTTCTTCTTATTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_019080 |
| Insert Size | 1011 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_019080.1 |
| RefSeq Size | 4666 bp |
| RefSeq ORF | 1011 bp |
| Locus ID | 54602 |
| UniProt ID | Q9NV92 |
| Protein Families | Transmembrane |
| MW | 36.4 kDa |
| Gene Summary | Activates HECT domain-containing E3 ubiquitin-protein ligases, including ITCH, NEDD4, NEDD4L, SMURF2, WWP1 and WWP2, and consequently modulates the stability of their targets. As a result, may control many cellular processes. Recruits ITCH, NEDD4 and SMURF2 to endosomal membranes. Negatively regulates KCNH2 potassium channel activity by decreasing its cell-surface expression and interfering with channel maturation through recruitment of NEDD4L to the Golgi apparatus and multivesicular body where it mediates KCNH2 degradation (PubMed:26363003). May modulate EGFR signaling. Together with NDFIP1, limits the cytokine signaling and expansion of effector Th2 T-cells by promoting degradation of JAK1, probably by ITCH- and NEDD4L-mediated ubiquitination (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220371 | NDFIP2 (Myc-DDK-tagged)-Human Nedd4 family interacting protein 2 (NDFIP2), transcript variant 1 |
CNY 3656.00 |
|
| RC220371L3 | Lenti ORF clone of Human Nedd4 family interacting protein 2 (NDFIP2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC220371L4 | Lenti ORF clone of Human Nedd4 family interacting protein 2 (NDFIP2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG220371 | NDFIP2 (tGFP-tagged) - Human Nedd4 family interacting protein 2 (NDFIP2), transcript variant 1 |
CNY 4370.00 |
