PPP1R14D (NM_017726) Human Untagged Clone

CAT#: SC304518

PPP1R14D (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1



  "NM_017726" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-PPP1R14D antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPI17-like; GBPI-1; GBPI1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304518 representing NM_017726.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGTCTTCAAGCCCTGCTTCCTGCACATCTCCCAGCCCAGATGGGGAGAACCCATGTAAGAAGGTC
CACTGGGCTTCTGGGAGGAGAAGGACATCATCCACAGACTCAGAGTCCAAGTCCCACCCGGACTCCTCC
AAGATACCCAGGTCCCGGAGACCCAGCCGCCTGACAGTGAAGTATGACCGGGGCCAGCTCCAGCGCTGG
CTGGAGATGGAGCAATGGGTGGATGCTCAAGTTCAGGAGCTCTTCCAGGATCAAGCAACCCCTTCTGAG
CCTGAGATTGACCTGGAAGCTCTCATGGATCTATCCACAGAGGAGCAGAAGACTCAGCTGGAGGCCATT
CTTGGGAACTGCCCCCGCCCCACAGAGGCTTTTATCTCTGAGCTGCTCAGTCAACTCAAGAAACTCCGG
AGACTCAGCCGGCCTCAGAAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_017726
Insert Size 438 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_017726.7
RefSeq Size 764 bp
RefSeq ORF 438 bp
Locus ID 54866
UniProt ID Q9NXH3
Protein Families Druggable Genome
MW 16.5 kDa
Gene Summary Protein phosphatase-1 (PP1; see MIM 176875) is a major cellular phosphatase that reverses serine/threonine protein phosphorylation. PPP1R14D is a PP1 inhibitor that itself is regulated by phosphorylation (Liu et al., 2004 [PubMed 12974676]).[supplied by OMIM, Feb 2010]
Transcript Variant: This variant (1) lacks an exon in the coding region, compared to variant 2, resulting in a frameshift and a protein (isoform 1) with a truncated C-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...