PPP1R14D (NM_017726) Human Untagged Clone
CAT#: SC304518
PPP1R14D (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPI17-like; GBPI-1; GBPI1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304518 representing NM_017726.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTGTCTTCAAGCCCTGCTTCCTGCACATCTCCCAGCCCAGATGGGGAGAACCCATGTAAGAAGGTC CACTGGGCTTCTGGGAGGAGAAGGACATCATCCACAGACTCAGAGTCCAAGTCCCACCCGGACTCCTCC AAGATACCCAGGTCCCGGAGACCCAGCCGCCTGACAGTGAAGTATGACCGGGGCCAGCTCCAGCGCTGG CTGGAGATGGAGCAATGGGTGGATGCTCAAGTTCAGGAGCTCTTCCAGGATCAAGCAACCCCTTCTGAG CCTGAGATTGACCTGGAAGCTCTCATGGATCTATCCACAGAGGAGCAGAAGACTCAGCTGGAGGCCATT CTTGGGAACTGCCCCCGCCCCACAGAGGCTTTTATCTCTGAGCTGCTCAGTCAACTCAAGAAACTCCGG AGACTCAGCCGGCCTCAGAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_017726 |
Insert Size | 438 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_017726.7 |
RefSeq Size | 764 bp |
RefSeq ORF | 438 bp |
Locus ID | 54866 |
UniProt ID | Q9NXH3 |
Protein Families | Druggable Genome |
MW | 16.5 kDa |
Gene Summary | Protein phosphatase-1 (PP1; see MIM 176875) is a major cellular phosphatase that reverses serine/threonine protein phosphorylation. PPP1R14D is a PP1 inhibitor that itself is regulated by phosphorylation (Liu et al., 2004 [PubMed 12974676]).[supplied by OMIM, Feb 2010] Transcript Variant: This variant (1) lacks an exon in the coding region, compared to variant 2, resulting in a frameshift and a protein (isoform 1) with a truncated C-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211763 | PPP1R14D (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1 |
CNY 1200.00 |
|
RC211763L3 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC211763L4 | Lenti ORF clone of Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG211763 | PPP1R14D (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 14D (PPP1R14D), transcript variant 1 |
CNY 4370.00 |
其它PPP1R14D产品