KDELR3 (NM_016657) Human Untagged Clone

CAT#: SC304445

KDELR3 (untagged)-Human KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 (KDELR3), transcript variant 2



  "NM_016657" in other vectors (6)

CNY 3,600.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-KDELR3 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ERD2L3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304445 representing NM_016657.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACGTGTTCCGAATCCTCGGCGACCTGAGCCACCTCCTGGCCATGATCTTGCTGCTGGGGAAGATC
TGGAGGTCCAAGTGCTGCAAGGGCATCTCTGGGAAGAGCCAGATCCTGTTTGCTCTCGTCTTCACCACC
AGGTACCTGGACCTGTTCACCAACTTCATCTCCATCTACAACACAGTAATGAAGGTGGTTTTTCTCCTC
TGTGCCTATGTTACAGTGTACATGATATATGGGAAATTCCGTAAAACTTTTGACAGTGAGAATGACACA
TTCCGCCTGGAGTTTCTTCTGGTCCCAGTCATTGGCCTTTCCTTCCTTGAAAACTACAGTTTCACTCTG
CTGGAGATCCTCTGGACTTTCTCTATCTATCTGGAATCAGTGGCTATCCTGCCCCAGCTCTTCATGATC
AGCAAGACTGGAGAGGCTGAGACCATAACTACTCACTACCTGTTCTTTCTGGGTCTGTACCGGGCACTC
TACCTGGCTAACTGGATCAGGCGGTACCAGACTGAGAATTTCTATGACCAAATTGCAGTCGTGTCTGGA
GTAGTACAAACCATCTTCTACTGTGACTTCTTCTACTTGTATGTGACCAAAGGTAGGTCCTGGGATGAC
AGCAATGCTGACACTGGCCTAAGGAGTTACTCATCCATTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016657
Insert Size 663 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016657.2
RefSeq Size 960 bp
RefSeq ORF 663 bp
Locus ID 11015
UniProt ID O43731
Protein Families Druggable Genome, Transmembrane
Protein Pathways Vibrio cholerae infection
MW 25.7 kDa
Gene Summary This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. It encodes isoform b which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...