SPAG11B (NM_016512) Human Untagged Clone
CAT#: SC304426
SPAG11B (untagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant A
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EDDM2B; EP2; EP2C; EP2D; HE2; HE2C; SPAG11; SPAG11A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC304426 representing NM_016512.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGCAACGATTGCTCCCGTCCGTCACCAGCCTTCTCCTTGTGGCCCTGCTGTTTCCAGGATCGTCT CAAGCCAGACATGTGAACCACTCAGCCACTGAGGCTCTCGGAGAACTCAGGGAAAGAGCCCCTGGGCAA GGCACAAACGGGTTTCAGCTGCTACGCCACGCAGTGAAACGGGACCTCTTACCACCGCGCACCCCACCT TACCAAGTGCACATCTCTCACCGGGAGGCTCGAGGACCCTCATTTAGGATCTGTGTGGACTTTTTAGGG CCTAGATGGGCCAGGGGATGTTCCACCGGGAATTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_016512 |
| Insert Size | 312 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_016512.3 |
| RefSeq Size | 794 bp |
| RefSeq ORF | 312 bp |
| Locus ID | 10407 |
| UniProt ID | Q08648 |
| Protein Families | Secreted Protein |
| MW | 11.4 kDa |
| Gene Summary | This gene encodes several androgen-dependent, epididymis-specific secretory proteins. The specific functions of these proteins have not been determined, but they are thought to be involved in sperm maturation. Some of the isoforms contain regions of similarity to beta-defensins, a family of antimicrobial peptides. The gene is located on chromosome 8p23 near the defensin gene cluster. Alternative splicing of this gene results in seven transcript variants encoding different isoforms. Two different N-terminal and five different C-terminal protein sequences are encoded by the splice variants. Two additional variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (A) is also called the alpha1 transcript. It lacks two internal exons and encodes an isoform (A) whose C-terminus is identical to that of isoform B encoded by variant B. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208855 | SPAG11B (Myc-DDK-tagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant A |
CNY 3656.00 |
|
| RC208855L3 | Lenti ORF clone of Human sperm associated antigen 11B (SPAG11B), transcript variant A, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC208855L4 | Lenti ORF clone of Human sperm associated antigen 11B (SPAG11B), transcript variant A, mGFP tagged |
CNY 5890.00 |
|
| RG208855 | SPAG11B (tGFP-tagged) - Human sperm associated antigen 11B (SPAG11B), transcript variant A |
CNY 4370.00 |
|
| SC321131 | SPAG11B (untagged)-Human sperm associated antigen 11B (SPAG11B), transcript variant A |
CNY 1200.00 |
其它SPAG11B产品
