WNT16 (NM_016087) Human Untagged Clone
CAT#: SC304380
WNT16 (untagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2
CNY 3656.00
CNY 5700.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_016087 edited
CCATGCAGCTCACCACTTGCCTCAGGGAGACCCTCTTCACAGGGGCTTCTCAAAAGACCT CCCTATGGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTGCGCCAATT TGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCA TCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGAT GGAACTGCATGATCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTG GCTACGAGCTGAGCAGCGGCACCAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAG GCCTGGTGCATTCTGTGACCAGGTCATGCAGTGCAGGCAACATGACAGAGTGTTCCTGTG ACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAAGGCTGGCACTGGGGGGGCTGCTCCG ATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGATTTCCCCATCGGAAACA CCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAAGCTGGAA GGCAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCT GTGCTGTGAAAACATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGA AGGATAAATATGAAAACAGTATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGA GAGAAAAAGATCAGAGGAAAATACCAATCCATAAGGATGATCTGCTCTATGTTAATAAGT CTCCCAACTACTGTGTAGAAGATAAGAAACTGGGAATCCCAGGGACACAAGGCAGAGAAT GCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTCCTCTGCTGTGGCCGAGGTTACA ACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATCTGGTGCTGCTATG TCCGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAAC |
Restriction Sites | Please inquire |
ACCN | NM_016087 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_016087.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016087.2, NP_057171.2 |
RefSeq Size | 2894 bp |
RefSeq ORF | 1068 bp |
Locus ID | 51384 |
UniProt ID | Q9UBV4 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
Gene Summary | The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs from variant 1 at the 5' terminus including 5' UTR and the coding region for the N-terminus. It encodes a shorter isoform than variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222372 | WNT16 (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2 |
CNY 3656.00 |
|
RC222372L1 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, Myc-DDK-tagged |
CNY 6056.00 |
|
RC222372L2 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC222372L3 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC222372L4 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG222372 | WNT16 (tGFP-tagged) - Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2 |
CNY 5256.00 |