TMEM158 (NM_015444) Human Untagged Clone
CAT＃: SC304318
TMEM158 (untagged)-Human transmembrane protein 158 (gene/pseudogene) (TMEM158)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BBP; p40BBP; RIS1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_015444 edited
ATGCTGCCCCTGCTCGCCGCGCTCCTGGCCGCCGCCTGCCCGCTGCCGCCCGTCCGCGGC GGGGCCGCGGACGCGCCCGGCCTCCTCGGGGTGCCCTCCAATGCTTCAGTCAACGCGTCC TCCGCGGACGAGCCCATCGCCCCGCGGCTGCTGGCCTCGGCGGCCCCCGGGCCCCCCGAG CGCCCGGGCCCGGAGGAGACGGCGGCGGCAGCGGCGCCGTGCAACATCAGCGTGCAGCGG CAGATGCTGAGCTCGCTGCTCGTGCGCTGGGGCCGCCCGCGGGGCTTCCAGTGCGACCTA CTGCTCTTCTCCACCAACGCGCACGGCCGCGCTTTCTTCGCCGCCGCCTTCCACCGCGTC GGGCCGCCGCTGCTCATCGAGCACCTGGGGCTGGCGGCGGGCGGCGCGCAGCAGGACCTG CGCCTCTGCGTGGGCTGCGGCTGGGTGCGCGGTCGCCGCACTGGCCGCCTCCGGCCCGCC GCCGCCCCCAGCGCCGCCGCCGCCACCGCCGGGGCGCCCACCGCGCTGCCAGCCTACCCC GCGGCCGAGCCGCCCGGGCCGCTGTGGCTGCAGGGCGAGCCGCTGCATTTCTGCTGCCTA GACTTCAGCCTGGAGGAGCTGCAGGGCGAGCCGGGCTGGCGGCTGAACCGTAAGCCCATT GAGTCCACGCTGGTGGCCTGCTTCATGACCCTGGTCATCGTGGTGTGGAGCGTGGCCGCC CTCATCTGGCCGGTGCCCATCATCGCCGGCTTCCTGCCCAACGGCATGGAACAGCGCCGG ACCACCGCCAGCACCACCGCAGCCACCCCCGCCGCAGTGCCCGCAGGGACCACCGCAGCC GCCGCCGCCGCCGCCGCTGCCGCCGCCGCCGCGGCCGTCACTTCGGGGGTGGCGACCAAG TGA |
| Restriction Sites | Please inquire |
| ACCN | NM_015444 |
| Insert Size | 2000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | It is not a varient. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_015444.1, NP_056259.1 |
| RefSeq Size | 1797 bp |
| RefSeq ORF | 903 bp |
| Locus ID | 25907 |
| UniProt ID | Q8WZ71 |
| Protein Families | Druggable Genome |
| Gene Summary | Constitutive activation of the Ras pathway triggers an irreversible proliferation arrest reminiscent of replicative senescence. Transcription of this gene is upregulated in response to activation of the Ras pathway, but not under other conditions that induce senescence. The encoded protein is similar to a rat cell surface receptor proposed to function in a neuronal survival pathway. An allelic polymorphism in this gene results in both functional and non-functional (frameshifted) alleles; the reference genome represents the functional allele. [provided by RefSeq, Jul 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224658 | TMEM158 (Myc-DDK-tagged)-Human transmembrane protein 158 (gene/pseudogene) (TMEM158) |
CNY 3600.00 |
|
| RC224658L1 | Lenti ORF clone of Human transmembrane protein 158 (gene/pseudogene) (TMEM158), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC224658L2 | Lenti ORF clone of Human transmembrane protein 158 (gene/pseudogene) (TMEM158), mGFP tagged |
CNY 6000.00 |
|
| RC224658L3 | Lenti ORF clone of Human transmembrane protein 158 (gene/pseudogene) (TMEM158), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224658L4 | Lenti ORF clone of Human transmembrane protein 158 (gene/pseudogene) (TMEM158), mGFP tagged |
CNY 6000.00 |
|
| RG224658 | TMEM158 (tGFP-tagged) - Human transmembrane protein 158 (gene/pseudogene) (TMEM158) |
CNY 5200.00 |
其它TMEM158产品
