PLA2G2E (NM_014589) Human Untagged Clone

CAT#: SC304136

PLA2G2E (untagged)-Human phospholipase A2, group IIE (PLA2G2E)



  "NM_014589" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PLA2G2E Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GIIE sPLA2; sPLA2-IIE
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC304136 representing NM_014589.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAATCTCCCCACGTGCTGGTGTTCCTTTGCCTCCTGGTGGCTCTGGTCACCGGGAACCTGGTTCAG
TTTGGGGTGATGATCGAGAAGATGACAGGCAAGTCCGCCCTGCAGTACAACGACTATGGCTGTTACTGC
GGCATCGGTGGCTCCCACTGGCCGGTGGACCAGACTGACTGGTGCTGCCACGCCCACGACTGCTGCTAC
GGGCGTCTGGAGAAGCTGGGCTGTGAGCCCAAACTGGAAAAGTATCTTTTCTCTGTCAGCGAACGTGGC
ATTTTCTGCGCCGGCAGGACCACCTGCCAGCGGCTGACCTGCGAGTGTGACAAGAGGGCTGCCCTCTGC
TTTCGCCGCAACCTGGGCACCTACAACCGCAAATATGCCCATTATCCCAACAAGCTGTGCACCGGGCCC
ACCCCGCCCTGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_014589
Insert Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_014589.2
RefSeq Size 487 bp
RefSeq ORF 429 bp
Locus ID 30814
UniProt ID Q9NZK7
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway
MW 16 kDa
Gene Summary PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. Has a preference for arachidonic-containing phospholipids.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...