OBP2A (NM_014582) Human Untagged Clone
CAT#: SC304133
OBP2A (untagged)-Human odorant binding protein 2A (OBP2A)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | hOBPIIa; LCN13; OBP; OBP2C; OBPIIa |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_014582 edited
CCGAGGTCGGCAGCACAGAGCTCTGGAGATGAAGACCCTGTTCCTGGGTGTCACGCTCGG CCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTACGT GAAGGCCATGGTGGTCGATAAGGACTTTCCGGAGGACAGGAGGCCCAGGAAGGTGTCCCC AGTGAAGGTGACAGCCCTGGGCGGTGGGAACTTGGAAGCCACGTTCACCTTCATGAGGGA GGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATTCAG CGCCTATGGGGGCAGGAAGCTCATATACCTGCAGGAGCTGCCCGGGACGGACGACTACGT CTTTTACTGCAAAGACCAGCGCCGTGGGGGCCTGCGCTACATGGGAAAGCTTGTGGGTAG GAATCCTAATACCAACCTGGAGGCCCTGGAAGAATTTAAGAAATTGGTGCAGCACAAGGG ACTCTCGGAGGAGGACATTTTCATGCCCCTGCAGACGGGAAGCTGCGTTCTCGAACACTA GGCAGCCCCCGGGTCTGCACCTCCAGAGCCCACCCTACCACCAGACACAGA |
Restriction Sites | Please inquire |
ACCN | NM_014582 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014582.1, NP_055397.1 |
RefSeq Size | 676 bp |
RefSeq ORF | 513 bp |
Locus ID | 29991 |
UniProt ID | Q9NY56 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (alpha, PMID:10607840) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant gamma. It encodes isoform alpha, which has a shorter and distinct C-terminus, compared to isoform gamma. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210114 | OBP2A (Myc-DDK-tagged)-Human odorant binding protein 2A (OBP2A) |
CNY 2400.00 |
|
RC210114L1 | Lenti ORF clone of Human odorant binding protein 2A (OBP2A), Myc-DDK-tagged |
CNY 4800.00 |
|
RC210114L2 | Lenti ORF clone of Human odorant binding protein 2A (OBP2A), mGFP tagged |
CNY 5890.00 |
|
RC210114L3 | Lenti ORF clone of Human odorant binding protein 2A (OBP2A), Myc-DDK-tagged |
CNY 4800.00 |
|
RC210114L4 | Lenti ORF clone of Human odorant binding protein 2A (OBP2A), mGFP tagged |
CNY 4800.00 |
|
RG210114 | OBP2A (tGFP-tagged) - Human odorant binding protein 2A (OBP2A) |
CNY 4000.00 |