SMR3A (NM_012390) Human Untagged Clone
CAT#: SC303974
SMR3A (untagged)-Human submaxillary gland androgen regulated protein 3A (SMR3A)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | P-B1; PBI; PRL5; PROL5 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_012390 edited
ATGAAATCACTGACTTGGATCTTGGGCCTTTGGGCTCTTGCAGCGTGTTTCACACCTGGT GAGAGTCAAAGAGGCCCCAGGGGACCATATCCACCTGGACCACTGGCTCCTCCTCCTCCA CCATGTTTTCCTTTTGGAACAGGATTTGTTCCACCACCCCATCCTCCACCCTATGGTCCA GGGAGATTTCCACCACCCCTTTCTCCACCCTATGGTCCAGGGAGAATCCCACCATCCCCT CCTCCACCCTATGGTCCAGGGAGAATTCAATCACACTCTCTTCCTCCTCCTTATGGCCCA GGTTATCCACAGCCACCTTCCCAACCAAGACCCTATCCACCTGGACCTCCATTTTTCCCT GTAAATTCTCCAACTGATCCTGCCCTCCCTACTCCTGCACCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_012390 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_012390.3, NP_036522.3 |
| RefSeq Size | 598 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 26952 |
| UniProt ID | Q99954 |
| Protein Families | Secreted Protein |
| Gene Summary | May play a role in protection or detoxification.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212709 | SMR3A (Myc-DDK-tagged)-Human submaxillary gland androgen regulated protein 3A (SMR3A) |
CNY 1200.00 |
|
| RC212709L1 | Lenti ORF clone of Human submaxillary gland androgen regulated protein 3A (SMR3A), Myc-DDK-tagged |
CNY 3600.00 |
|
| RC212709L2 | Lenti ORF clone of Human submaxillary gland androgen regulated protein 3A (SMR3A), mGFP tagged |
CNY 5890.00 |
|
| RC212709L3 | Lenti ORF clone of Human submaxillary gland androgen regulated protein 3A (SMR3A), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212709L4 | Lenti ORF clone of Human submaxillary gland androgen regulated protein 3A (SMR3A), mGFP tagged |
CNY 5890.00 |
|
| RG212709 | SMR3A (tGFP-tagged) - Human submaxillary gland androgen regulated protein 3A (SMR3A) |
CNY 2800.00 |
