KLRC3 (NM_007333) Human Untagged Clone

CAT#: SC303911

KLRC3 (untagged)-Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 2



  "NM_007333" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


KLRC3 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NKG2-E; NKG2E
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303911 representing NM_007333.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGTGGCAGCAAAGGAAA
CCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTCCAAGTAGAATTAAACCTTCAA
AATGCTTCTCTGAATCATCAAGGGATTGATAAAATATATGACTGCCAAGGTTTACTGCCACCTCCAGAA
AAGCTCACTGCCGAGGTCCTAGGAATCATTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTT
CTTATTCCTTTCCTGGAGCAGAACAATTCTTCCCCGAATGCAAGAACCCAGAAAGCACGTCATTGTGGC
CATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGG
GAAGAGAGTTTGCAGGCCTGTGCTTCAAAGAACTCTTCTAGTCTGCTTTGTATAGATAATGAAGAAGAA
ATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCA
TGGGTGACAATAAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATCATGCTGAACGTAACTGT
GCAATGCTACATGTACGTGGACTTATATCAGACCAGTGTGGATCTTCAAGAATCATTGTGAGCATAAGC
TTTAGAATTAAAGCGCTTGAGCTTGCAGTGCATCAGATAAAATTTTATATTTGTTCAAACAGAAATGAT
ATTATGATTGCATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_007333
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_007333.2
RefSeq Size 843 bp
RefSeq ORF 774 bp
Locus ID 3823
UniProt ID Q07444
Protein Families Transmembrane
Protein Pathways Antigen processing and presentation, Natural killer cell mediated cytotoxicity
MW 29 kDa
Gene Summary Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2), also known as NKG2-H, uses an alternate splice site and lacks an exon in the 3' coding region, compared to variant 1. The resulting protein (isoform H) contains a distinct C-terminus, compared to isoform E.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...