HOXA7 (NM_006896) Human Untagged Clone

CAT#: SC303846

HOXA7 (untagged)-Human homeobox A7 (HOXA7)



  "NM_006896" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HOXA7 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANTP; HOX1; HOX1.1; HOX1A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_006896, the custom clone sequence may differ by one or more nucleotides
ATGAGTTCTTCGTATTATGTGAACGCGCTTTTTAGCAAATATACGGCGGGGGCTTCTCTG
TTCCAAAATGCCGAGCCGACTTCTTGCTCCTTTGCTCCCAACTCACAGAGAAGCGGCTAC
GGGGCGGGCGCCGGCGCCTTCGCCTCGACCGTTCCGGGCTTATACAATGTCAACAGCCCC
CTTTATCAGAGCCCCTTTGCGTCCGGCTACGGCCTGGGCGCCGACGCCTACGGCAACCTG
CCCTGCGCCTCCTACGACCAAAACATCCCCGGGCTCTGCAGTGACCTCGCCAAAGGCGCC
TGCGACAAGACGGACGAGGGCGCGCTGCATGGCGCGGCTGAGGCCAATTTCCGCATCTAC
CCCTGGATGCGGTCTTCAGGACCTGACAGGAAGCGGGGCCGCCAGACCTACACGCGCTAC
CAGACGCTGGAGCTGGAGAAGGAGTTCCACTTCAACCGCTACCTGACGCGGCGCCGCCGC
ATTGAAATCGCCCACGCGCTCTGCCTCACCGAGCGCCAGATTAAGATCTGGTTCCAGAAC
CGCCGCATGAAGTGGAAGAAAGAGCATAAGGACGAAGGTCCGACTGCCGCCGCAGCTCCC
GAGGGCGCCGTGCCCTCTGCCGCCGCCACTGCTGCCGCGGACAAGGCCGACGAGGAGGAC
GATGATGAAGAAGAGGAAGACGAGGAGGAATGA
Restriction Sites Please inquire     
ACCN NM_006896
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006896.3, NP_008827.2
RefSeq Size 2018 bp
RefSeq ORF 693 bp
Locus ID 3204
UniProt ID P31268
Protein Families Transcription Factors
Gene Summary In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. For example, the encoded protein represses the transcription of differentiation-specific genes during keratinocyte proliferation, but this repression is then overcome by differentiation signals. This gene is highly similar to the antennapedia (Antp) gene of Drosophila. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...