COLEC10 (NM_006438) Human Untagged Clone
CAT#: SC303774
COLEC10 (untagged)-Human collectin sub-family member 10 (C-type lectin) (COLEC10)
CNY 2400.00
CNY 6270.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 3MC3; CL-10; CL-34; CLL1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_006438 edited
TTTGGCATTTCTGGGAGACCCTTTTCTGAGGAACCACAGCAATGAATGGCTTTGCATCCT TGCTTCGAAGAAACCAATTTATCCTCCTGGTACTATTTCTTTTGCAAATTCAGAGTCTGG GTCTGGATATTGATAGCCGTCCTACCGCTGAAGTCTGTGCCACACACACAATTTCACCAG GACCCAAAGGAGATGATGGTGAAAAAGGAGATCCAGGAGAAGAGGGAAAGCATGGCAAAG TGGGACGCATGGGGCCGAAAGGAATTAAAGGAGAACTGGGTGATATGGGAGATCAGGGCA ATATTGGCAAGACTGGGCCCATTGGGAAGAAGGGTGACAAAGGGGAAAAAGGTTTGCTTG GAATACCTGGAGAAAAAGGCAAAGCAGGTACTGTCTGTGATTGTGGAAGATACCGGAAAT TTGTTGGACAACTGGATATTAGTATTGCTCGGCTCAAGACATCTATGAAGTTTGTCAAGA ATGTGATAGCAGGGATTAGGGAAACTGAAGAGAAATTCTACTACATCGTGCAGGAAGAGA AGAACTACAGGGAATCCCTAACCCACTGCAGGATTCGGGGTGGAATGCTAGCCATGCCCA AGGATGAAGCTGCCAACACACTCATCGCTGACTATGTTGCCAAGAGTGGCTTCTTTCGGG TGTTCATTGGCGTGAATGACCTTGAAAGGGAGGGACAGTACATGTTCACAGACAACACTC CACTGCAGAACTATAGCAACTGGAATGAGGGGGAACCCAGCGACCCCTATGGTCATGAGG ACTGTGTGGAGATGCTGAGCTCTGGCAGATGGAATGACACAGAGTGCCATCTTACCATGT ACTTTGTCTGTGAGTTCATCAAGAAGAAAAAGTAACTTCCCTCATCCTACGTATTTGCTA TTTTCCTGTGACCGTCATTACAGTTATTGTTATCCATCCTTTTTTTCCTGATTGTACTAC ATTTGATCTGAGTCAACATAGCTAGAAAATGCTAAACTGAGGTATGGAGCCTCCATCATC ATGCTCTTTTGTGATGATTTTCATATTTTCACACATGGTATATTATTGACCCAATAACTC GCCAGGTTACATGGGTCTTGAGAGAGAATTTTAATTACTAATTGTGCACGAGATAGTTGG TTGTCTATATGTCAAATGAGTTGTTCTCTTGGTATTTGCTCTACCATCTCTCCCTAGAGC ACTCTGTGTCTATCCCAGTGGATAATTTCCCAGTTTACTGGTGATGATTAGGAAGGTTGT TGATGG |
| Restriction Sites | Please inquire |
| ACCN | NM_006438 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006438.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006438.2, NP_006429.1 |
| RefSeq Size | 1686 bp |
| RefSeq ORF | 834 bp |
| Locus ID | 10584 |
| UniProt ID | Q9Y6Z7 |
| Gene Summary | This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins. [provided by RefSeq, Jul 2008] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
COLEC10 is mutated in 3MC patients and regulates early craniofacial development
,Munye, MM;Diaz-Font, A;Ocaka, L;Henriksen, ML;Lees, M;Brady, A;Jenkins, D;Morton, J;Hansen, SW;Bacchelli, C;Beales, PL;Hernandez-Hernandez, V;,
PLoS Genet
,PubMed ID 28301481
[COLEC10]
|
|
Investigations on Collectin Liver 1
,Esben Axelgaard, Lisbeth Jensen, Thomas F. Dyrlund, Hans J. Nielsen, Jan J. Enghild, Steffen Thiel, and Jens C. Jensenius,
J. Biol. Chem., Aug 2013; 288: 23407 - 23420.
,PubMed ID 23814060
[COLEC10]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220039 | COLEC10 (Myc-DDK-tagged)-Human collectin sub-family member 10 (C-type lectin) (COLEC10) |
CNY 2400.00 |
|
| RC220039L1 | Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC220039L2 | Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), mGFP tagged |
CNY 5890.00 |
|
| RC220039L3 | Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC220039L4 | Lenti ORF clone of Human collectin sub-family member 10 (C-type lectin) (COLEC10), mGFP tagged |
CNY 5890.00 |
|
| RG220039 | COLEC10 (tGFP-tagged) - Human collectin sub-family member 10 (C-type lectin) (COLEC10) |
CNY 4000.00 |
其它COLEC10产品
