SPRR1A (NM_005987) Human Untagged Clone

CAT#: SC303714

SPRR1A (untagged)-Human small proline-rich protein 1A (SPRR1A), transcript variant 2



  "NM_005987" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
SPRR1A Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SPRK
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005987 edited
CCAAGGGACCACACAGCCCATTCTGCTCCGTATACCAGAAAAAAACACATTTGAAGCATG
AATTCTCAGCAGCAGAAGCAGCCTTGCACCCCACCCCCTCAGCCTCAGCAGCAGCAGGTG
AAACAACCTTGCCAGCCTCCACCCCAGGAACCATGCATCCCCAAAACCAAGGAGCCCTGC
CAACCCAAGGTGCCTGAGCCCTGCCACCCCAAAGTGCCTGAGCCCTGCCAGCCCAAGATT
CCAGAGCCCTGCCAGCCCAAGGTGCCTGAGCCCTGCCCTTCAACGGTCACTCCAGCACCA
GCCCAGCAGAAGACCAAGCAGAAGTAATGTGGTCCACAGCCATGCCCTTGAGGAGCTGGC
C
Restriction Sites Please inquire     
ACCN NM_005987
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to differ from the protein associated to this reference by two amino acids.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005987.2, NP_005978.2
RefSeq Size 664 bp
RefSeq ORF 270 bp
Locus ID 6698
UniProt ID P35321
Gene Summary Cross-linked envelope protein of keratinocytes. It is a keratinocyte protein that first appears in the cell cytosol, but ultimately becomes cross-linked to membrane proteins by transglutaminase. All that results in the formation of an insoluble envelope beneath the plasma membrane.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an alternate splice site, resulting in a shorter 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...