RND2 (NM_005440) Human Untagged Clone
CAT＃: SC303645
RND2 (untagged)-Human Rho family GTPase 2 (RND2)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARHN; RHO7; RhoN |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303645 representing NM_005440.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGGGCAGAGCGGCCGCTGCAAGATCGTGGTGGTGGGAGACGCAGAGTGCGGCAAGACGGCGCTG CTGCAGGTGTTCGCCAAGGACGCCTATCCCGGGAGTTATGTCCCCACCGTGTTTGAGAACTACACTGCG AGCTTTGAGATCGACAAGCGCCGCATTGAGCTCAACATGTGGGACACTTCAGGTTCCTCTTACTATGAT AATGTCCGGCCTCTGGCCTATCCTGATTCTGATGCTGTGCTCATCTGCTTCGACATTAGCCGACCAGAA ACACTGGACAGTGTTCTCAAGAAGTGGCAAGGAGAGACTCAAGAGTTCTGCCCCAATGCCAAGGTTGTG CTGGTTGGCTGTAAACTGGACATGCGGACTGACCTGGCCACACTGAGGGAGCTGTCCAAGCAGAGGCTT ATCCCTGTTACACATGAGCAGGGCACTGTGCTGGCCAAGCAGGTGGGGGCTGTGTCCTATGTTGAGTGC TCCTCCCGGTCCTCTGAGCGCAGCGTCAGGGATGTCTTCCATGTGGCTACAGTGGCCTCCCTTGGCCGT GGCCATAGGCAGCTGCGCCGAACTGACTCACGCCGGGGAATGCAGCGATCCGCTCAGCTGTCAGGACGG CCAGACCGGGGGAATGAGGGCGAGATACACAAGGATCGAGCCAAAAGCTGCAACCTCATGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_005440 |
| Insert Size | 684 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_005440.4 |
| RefSeq Size | 4169 bp |
| RefSeq ORF | 684 bp |
| Locus ID | 8153 |
| UniProt ID | P52198 |
| MW | 25.4 kDa |
| Gene Summary | This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221840 | RND2 (Myc-DDK-tagged)-Human Rho family GTPase 2 (RND2) |
CNY 2400.00 |
|
| RC221840L1 | Lenti ORF clone of Human Rho family GTPase 2 (RND2), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC221840L2 | Lenti ORF clone of Human Rho family GTPase 2 (RND2), mGFP tagged |
CNY 5890.00 |
|
| RC221840L3 | Lenti ORF clone of Human Rho family GTPase 2 (RND2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC221840L4 | Lenti ORF clone of Human Rho family GTPase 2 (RND2), mGFP tagged |
CNY 5890.00 |
|
| RG221840 | RND2 (tGFP-tagged) - Human Rho family GTPase 2 (RND2) |
CNY 4000.00 |
