KIF25 (NM_005355) Human Untagged Clone

CAT#: SC303623

KIF25 (untagged)-Human kinesin family member 25 (KIF25), transcript variant 2



  "NM_005355" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
KIF25 mouse monoclonal antibody, clone OTI2F4 (formerly 2F4)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KNSL3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303623 representing NM_005355.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACATGGACCTCAGGTCAGCTTCAGCGTGAGAAGCAGGCCAGGCCTGGGTCTGGAGCCGTCCTGGCC
TTCCCAGATGACAAGGACCTCAGGGTTTATGGTCCAGCAGAGTCTCAGAGCGCGGTCTTTGGAGATGTG
TGCCCCCTACTCACTTCTCTCTTGGATGGGTACAATGTTTGTGTTATGGCGTATGGACAGACGGGCAGC
GGAAAGAGCTATACCATGCTGGGACGCCATTCGGACGACGGCCCTGTTCTGCCGCTTGACCCACAGAGT
GACTTAGGAATTATCCCTAGAGTGGCTGAGGAGCTCTTCAGGCTCATTTTGGAAAATACCTCAAGAAGC
CCAAAGGTTGAAGTCTCCATAGTGGAAGTTTACAATAATGACATTTTTGACCTTCTGGCCAAAGACAGC
ATTGCAGCAGTGTCGGGGGTCAAGCGTGAGGTGGTGACAGCCAAGGATGGACGGACAGAGGTTGCGCTG
CTGGCCTCTGAGGCTGTCGGCAGCGCCTCGAAACTGATGGAGCTCGTTCATGGAGGTCTGCAGCTCAGG
GCGAAGCACCCCACCCTGGTGCACGCGGATTCCTCCAGGTCTCACCTGATAATTACGGTGACTCTAACC
ACAGCCTCCTGCTCTGACAGCACTGCAGACCAAGCCTGCAGTGCCACCCTCCCCAGGGAGCAAACAGAG
GCAGGAAGGGCAGGAAGGAGCCGCAGAGCTTCTCAAGGGGCCTTGGCTCCACAGCTGGTTCCTGGGAAC
CCCGCAGGGCATGCGGAGCAGGTGCAGGCTCGACTACAGCTCGTGGACTCGGCCGGCAGCGAGTGCGTT
GGAGGCGATGCGAAGTTACTGGTGATTCTCTGCATTTCTCCCAGCCAGAGGCACCTGGCACAGACGTTG
CAGGGCCTGGGTTTCGGGATCCGAGCTCGGCAAGTCCAGCGAGGCCCTGCCCGAAAGAAGCCGCCCAGC
TCCCAAACGGAGGGGAAGAGGAGGCCGGATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_005355
Insert Size 999 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005355.3
RefSeq Size 1354 bp
RefSeq ORF 999 bp
Locus ID 3834
UniProt ID Q9UIL4
Protein Families Druggable Genome
MW 35.2 kDa
Gene Summary The protein encoded by this gene is a member of the kinesin-like protein family. Protein family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. However, the particular function of this gene product has not yet been determined. Two alternatively spliced transcript variants which encode products have been described. Other splice variants have been found that lack exon 2 and the initiation codon for translation. [provided by RefSeq, Jul 2008]
Transcript Variant: This transcript (2) lacks exon 8, and encodes a shorter protein. The protein lacks an internal protein fragment, compared to that encoded by transcript variant 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...