BD2 (DEFB4A) (NM_004942) Human Untagged Clone
CAT#: SC303551
DEFB4A (untagged)-Human defensin, beta 4A (DEFB4A)
CNY 1200.00
CNY 3990.00
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | BD-2; DEFB-2; DEFB2; DEFB4; DEFB102; HBD-2; SAP1 | 
| Vector | pCMV6-XL5 | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | None | 
| Sequence Data | 
                
                
                
                 >OriGene sequence for NM_004942 edited 
TGGTGAAGCTCCCAGCCATCAGCCATGAGGGTCTTGTATCTCCTCTTCTCGTTCCTCTTC ATATTCCTGATGCCTCTTCCAGGTGTTTTTGGTGGTATAGGCGATCCTGTTACCTGCCTT AAGAGTGGAGCCATATGTCATCCAGTCTTTTGCCCTAGAAGGTATAAACAAATTGGCACC TGTGGTCTCCCTGGAACAAAATGCTGCAAAAAGCCATGAGGAGGCCAAGAAGCTGCTGTG GCTGATGCGGATT  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_004942 | 
| Insert Size | 250 bp | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004942.2. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_004942.2, NP_004933.1 | 
| RefSeq Size | 336 bp | 
| RefSeq ORF | 195 bp | 
| Locus ID | 1673 | 
| UniProt ID | O15263 | 
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane | 
| Gene Summary | Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 4, an antibiotic peptide which is locally regulated by inflammation. [provided by RefSeq, Jul 2008] | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC219487 | DEFB4A (Myc-DDK-tagged)-Human defensin, beta 4A (DEFB4A) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 1200.00  | 
                                            |
| RC219487L1 | Lenti ORF clone of Human defensin, beta 4A (DEFB4A), Myc-DDK-tagged | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3600.00  | 
                                            |
| RC219487L2 | Lenti ORF clone of Human defensin, beta 4A (DEFB4A), mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC219487L3 | Lenti ORF clone of Human defensin, beta 4A (DEFB4A), Myc-DDK-tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC219487L4 | Lenti ORF clone of Human defensin, beta 4A (DEFB4A), mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RG219487 | DEFB4A (tGFP-tagged) - Human defensin, beta 4A (DEFB4A) | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 2800.00  | 
                                            
