Kallikrein 4 (KLK4) (NM_004917) Human Untagged Clone
CAT＃: SC303547
KLK4 (untagged)-Human kallikrein-related peptidase 4 (KLK4)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI2A1; ARM1; EMSP; EMSP1; kallikrein; KLK-L1; PRSS17; PSTS |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_004917 edited
ATGGCCACAGCAGGAAATCCCTGGGGCTGGTTCCTGGGGTACCTCATCCTTGGTGTCGCA GGATCGCTCGTCTCTGGTAGCTGCAGCCAAATCATAAACGGCGAGGACTGCAGCCCGCAC TCGCAGCCCTGGCAGGCGGCACTGGTCATGGAAAACGAATTGTTCTGCTCGGGCGTCCTG GTGCATCCGCAGTGGGTGCTGTCAGCCGCACACTGTTTCCAGAACTCCTACACCATCGGG CTGGGCCTGCACAGTCTTGAGGCCGACCAAGAGCCAGGGAGCCAGATGGTGGAGGCCAGC CTCTCCGTACGGCACCCAGAGTACAACAGACCCTTGCTCGCTAACGACCTCATGCTCATC AAGTTGGACGAATCCGTGTCCGAGTCTGACACCATCCGGAGCATCAGCATTGCTTCGCAG TGCCCTACCGCGGGGAACTCTTGCCTCGTTTCTGGCTGGGGTCTGCTGGCGAACGGCAGA ATGCCTACCGTGCTGCAGTGCGTGAACGTGTCGGTGGTGTCTGAGGAGGTCTGCAGTAAG CTCTATGACCCGCTGTACCACCCCAGCATGTTCTGCGCCGGCGGAGGGCACGACCAGAAG GACTCCTGCAACGGTGACTCTGGGGGGCCCCTGATCTGCAACGGGTACTTGCAGGGCCTT GTGTCTTTCGGAAAAGCCCCGTGTGGCCAAGTTGGCGTGCCAGGTGTCTACACCAACCTC TGCAAATTCACTGAGTGGATAGAGAAAACCGTCCAGGCCAGTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004917 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004917.3, NP_004908.3 |
| RefSeq Size | 1347 bp |
| RefSeq ORF | 765 bp |
| Locus ID | 9622 |
| UniProt ID | Q9Y5K2 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Gene Summary | Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Several transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224493 | KLK4 (Myc-DDK-tagged)-Human kallikrein-related peptidase 4 (KLK4) |
CNY 2400.00 |
|
| RC224493L3 | Lenti ORF clone of Human kallikrein-related peptidase 4 (KLK4), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC224493L4 | Lenti ORF clone of Human kallikrein-related peptidase 4 (KLK4), mGFP tagged |
CNY 5890.00 |
|
| RG224493 | KLK4 (tGFP-tagged) - Human kallikrein-related peptidase 4 (KLK4) |
CNY 4370.00 |
其它Kallikrein 4产品
