ART1 (NM_004314) Human Untagged Clone
CAT#: SC303465
ART1 (untagged)-Human ADP-ribosyltransferase 1 (ART1)
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ART2; ARTC1; CD296; RT6 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_004314 edited
ATGCAGATGCCTGCTATGATGTCTCTGCTTCTTGTGTCTGTGGGCCTCATGGAAGCACTT CAGGCCCAGAGCCACCCCATCACACGACGAGACCTCTTCTCTCAAGAGATTCAGCTGGAC ATGGCCCTGGCCTCCTTTGATGACCAGTACGCTGGCTGTGCTGCTGCCATGACAGCTGCT CTCCCGGATCTCAACCACACGGAGTTCCAGGCCAACCAGGTGTATGCAGACAGCTGGACA CTGGCAAGCAGCCAATGGCAGGAGCGTCAGGCCAGGTGGCCAGAGTGGAGTCTCAGCCCC ACCCGTCCATCCCCGCCACCCCTGGGCTTCCGCGATGAGCATGGGGTGGCCCTCCTGGCC TACACAGCCAACAGCCCCCTGCACAAGGAGTTCAATGCAGCCGTGCGTGAGGCGGGCCGC TCCCGGGCCCACTACCTCCACCACTTCTCCTTCAAGACACTCCATTTCCTGCTGACTGAG GCCCTGCAGCTCCTGGGCAGCGGCCAGCGTCCACCCCGGTGCCACCAGGTGTTCCGAGGT GTGCACGGCCTGCGCTTCCGGCCAGCAGGGCCCCGGGCCACCGTGAGGCTGGGGGGCTTT GCTTCTGCCTCCCTGAAGCATGTTGCAGCCCAGCAGTTTGGTGAGGACACCTTCTTCGGC ATCTGGACCTGCCTTGGGGCCCCTATCAAGGGCTACTCCTTCTTCCCTGGAGAGGAAGAG GTGCTGATCCCCCCCTTTGAGACCTTCCAAGTGATCAATGCCAGCAGACTGGCCCAGGGC CCCGCCCGCATCTACCTCCGAGCCCTGGGCAAGCACAGCACCTACAACTGCGAGTACATC AAAGACAAGAAGTGCAAGTCTGGGCCTTGCCATCTGGATAATTCAGCCATGGGTCAGAGC CCCCTCTCTGCAGTCTGGTCTTTGCTGCTGCTGCTCTGGTTCCTCGTGGTGAGGGCCTTT CCAGATGGTCCAGGCCTCCTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_004314 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | There is 1 nucleotide difference between the OriGene clone and the NCBI reference ORF of NM_004314.1 at 769bp, changing the protein from Pro-->Leu. OriGene considers this to be a polymorphism and to reflect the natural differences between individuals. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004314.1, NP_004305.1 |
RefSeq Size | 1334 bp |
RefSeq ORF | 984 bp |
Locus ID | 417 |
UniProt ID | P52961 |
Gene Summary | ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220129 | ART1 (Myc-DDK-tagged)-Human ADP-ribosyltransferase 1 (ART1) |
CNY 3600.00 |
|
RC220129L1 | Lenti ORF clone of Human ADP-ribosyltransferase 1 (ART1), Myc-DDK-tagged |
CNY 6000.00 |
|
RC220129L2 | Lenti ORF clone of Human ADP-ribosyltransferase 1 (ART1), mGFP tagged |
CNY 5890.00 |
|
RC220129L3 | Lenti ORF clone of Human ADP-ribosyltransferase 1 (ART1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC220129L4 | Lenti ORF clone of Human ADP-ribosyltransferase 1 (ART1), mGFP tagged |
CNY 5890.00 |
|
RG220129 | ART1 (tGFP-tagged) - Human ADP-ribosyltransferase 1 (ART1) |
CNY 5200.00 |