BAG2 (NM_004282) Human Untagged Clone
CAT#: SC303461
BAG2 (untagged)-Human BCL2-associated athanogene 2 (BAG2)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BAG-2; dJ417I1.2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_004282 edited
GTGACCTCTTGGCTACCCCGCGTCGGAGGCTTAGATGGCTCAGGCGAAGATCAACGCTAA AGCCAACGAGGGGCGCTTCTGCCGCTCCTCCTCCATGGCTGACCGCTCCAGCCGCCTGCT GGAGAGCCTGGACCAGCTGGAGCTCAGGGTTGAAGCTTTGAGAGAAGCAGCAACTGCTGT TGAGCAAGAGAAAGAAATCCTTCTGGAAATGATCCACAGTATCCAAAATAGCCAGGACAT GAGGCAGATCAGTGACGGAGAAAGAGAAGAATTAAATCTGACTGCAAACCGTTTGATGGG AAGAACTCTCACCGTTGAAGTGTCAGTAGAAACAATTAGAAACCCCCAGCAGCAAGAATC CCTAAAGCATGCCACAAGGATTATTGATGAGGTGGTCAATAAGTTTCTGGATGATTTGGG AAATGCCAAGAGTCATTTAATGTCGCTCTACAGTGCATGTTCATCTGAGGTGCCACATGG GCCAGTTGATCAGAAGTTTCAATCCATAGTAATTGGCTGTGCTCTTGAAGATCAGAAGAA AATTAAGAGAAGATTAGAGACTCTGCTTAGAAATATTGAAAACTCTGACAAGGCCATCAA GCTATTAGAGCATTCTAAAGGAGCTGGTTCCAAAACTCTGCAACAAAATGCTGAAAGCAG ATTCAATTAGTCTTCAAACCTAAGAGCATTTACACAATACACAAGGTGTAAAAATGATAA AATACTATTTTAATTGATAACTAGTTCTTTGTTAGGTATAACCACTTAGTTGACACTGAT AGTTGTTTCAGATGAGGAAAATATTCCATCAAGTATCTTCAGTTTTGTGAATAACAAAAC TAGCAATATTTTAATTATCTATCTAGAGATTTTTTAGATTG |
Restriction Sites | Please inquire |
ACCN | NM_004282 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_004282.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004282.2, NP_004273.1 |
RefSeq Size | 1556 bp |
RefSeq ORF | 636 bp |
Locus ID | 9532 |
UniProt ID | O95816 |
Protein Families | Druggable Genome |
Gene Summary | BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220122 | BAG2 (Myc-DDK-tagged)-Human BCL2-associated athanogene 2 (BAG2) |
CNY 2400.00 |
|
RC220122L1 | Lenti ORF clone of Human BCL2-associated athanogene 2 (BAG2), Myc-DDK-tagged |
CNY 4800.00 |
|
RC220122L2 | Lenti ORF clone of Human BCL2-associated athanogene 2 (BAG2), mGFP tagged |
CNY 5890.00 |
|
RC220122L3 | Lenti ORF clone of Human BCL2-associated athanogene 2 (BAG2), Myc-DDK-tagged |
CNY 5890.00 |
|
RC220122L4 | Lenti ORF clone of Human BCL2-associated athanogene 2 (BAG2), mGFP tagged |
CNY 5890.00 |
|
RG220122 | BAG2 (tGFP-tagged) - Human BCL2-associated athanogene 2 (BAG2) |
CNY 4000.00 |