Ficolin 2 (FCN2) (NM_004108) Human Untagged Clone
CAT#: SC303435
FCN2 (untagged)-Human ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin) (FCN2), transcript variant SV0
CNY 6270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | EBP-37; FCNL; ficolin-2; P35 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_004108, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGGACAGAGCTGTGGGGGTCCTGGGCGCTGCCACCCTGCTGCTCTCTTTCCTG GGCATGGCCTGGGCTCTCCAGGCGGCAGACACCTGTCCAGAGGTGAAGATGGTGGGCCTG GAGGGCTCTGACAAGCTCACCATTCTCCGAGGCTGTCCGGGGCTGCCTGGGGCCCCTGGG CCCAAGGGAGAGGCAGGCACCAATGGAAAGAGAGGAGAACGTGGCCCCCCTGGACCTCCT GGGAAGGCAGGACCACCTGGGCCCAACGGAGCACCTGGGGAGCCCCAGCCGTGCCTGACA GGCCCGCGTACCTGCAAGGACCTGCTAGACCGAGGGCACTTCCTGAGCGGCTGGCACACC ATCTACCTGCCCGACTGCCGGCCCCTGACTGTGCTCTGTGACATGGACACGGACGGAGGG GGCTGGACCGTTTTCCAGCGGAGGGTGGATGGCTCTGTGGACTTCTACCGGGACTGGGCC ACGTACAAGCAGGGCTTCGGCAGTCGGCTGGGGGAGTTCTGGCTGGGGAATGACAACATC CACGCCCTGACCGCCCAGGGAACCAGCGAGCTCCGTGTAGACCTGGTGGACTTTGAGGAC AACTACCAGTTTGCTAAGTACAGATCATTCAAGGTGGCCGACGAGGCGGAGAAGTACAAT CTGGTCCTGGGGGCCTTCGTGGAGGGCAGTGCGGGAGATTCCCTGACGTTCCACAACAAC CAGTCCTTCTCCACCAAAGACCAGGACAATGATCTTAACACCGGAAATTGTGCTGTGATG TTTCAGGGAGCTTGGTGGTACAAAAACTGCCATGTGTCAAACCTGAATGGTCGCTACCTC AGGGGGACTCATGGCAGCTTTGCAAATGGCATCAACTGGAAGTCGGGGAAAGGATACAAT TATAGCTACAAGGTGTCAGAGATGAAGGTGCGACCTGCCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_004108 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004108.2, NP_004099.2 |
| RefSeq Size | 1057 bp |
| RefSeq ORF | 942 bp |
| Locus ID | 2220 |
| UniProt ID | Q15485 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Gene Summary | The product of this gene belongs to the ficolin family of proteins. This family is characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. This gene is predominantly expressed in the liver, and has been shown to have carbohydrate binding and opsonic activities. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (SV0) represents the longer transcript, and encodes the longer isoform (a). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Anti-Ficolin-2 and Anti-Ficolin-3 Autoantibody Detection by ELISA
,Dumestre-P?rard, C;Thielens, NM;,
Methods in molecular biology (Clifton, N.J.) 2021
,PubMed ID 33847937
[FCN2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210201 | FCN2 (Myc-DDK-tagged)-Human ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin) (FCN2), transcript variant SV0 |
CNY 3990.00 |
|
| RC210201L3 | Lenti-ORF clone of FCN2 (Myc-DDK-tagged)-Human ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin) (FCN2), transcript variant SV0 |
CNY 5890.00 |
|
| RC210201L4 | Lenti-ORF clone of FCN2 (mGFP-tagged)-Human ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin) (FCN2), transcript variant SV0 |
CNY 5890.00 |
|
| RG210201 | FCN2 (tGFP-tagged) - Human ficolin (collagen/fibrinogen domain containing lectin) 2 (hucolin) (FCN2), transcript variant SV0 |
CNY 4370.00 |
其它Ficolin 2产品
