FGF16 (NM_003868) Human Untagged Clone
CAT#: SC303395
FGF16 (untagged)-Human fibroblast growth factor 16 (FGF16)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FGF-16; MF4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_003868 edited
ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCG TCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAA ATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTGAAGGGGATCCTG CGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACG GTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCT GTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGA GGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAA GAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAG TATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACAC CAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCC AGAGACCTCTTTCACTATAGGTAA |
Restriction Sites | Please inquire |
ACCN | NM_003868 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003868.1, NP_003859.1 |
RefSeq Size | 624 bp |
RefSeq ORF | 624 bp |
Locus ID | 8823 |
UniProt ID | O43320 |
Protein Families | Secreted Protein |
Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
Gene Summary | This gene encodes a member of a family of proteins that are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene is expressed in cardiac cells and is required for proper heart development. Mutation in this gene was also observed in individuals with metacarpal 4-5 fusion. [provided by RefSeq, Mar 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221629 | FGF16 (Myc-DDK-tagged)-Human fibroblast growth factor 16 (FGF16) |
CNY 2400.00 |
|
RC221629L1 | Lenti ORF clone of Human fibroblast growth factor 16 (FGF16), Myc-DDK-tagged |
CNY 4800.00 |
|
RC221629L2 | Lenti ORF clone of Human fibroblast growth factor 16 (FGF16), mGFP tagged |
CNY 5890.00 |
|
RC221629L3 | Lenti ORF clone of Human fibroblast growth factor 16 (FGF16), Myc-DDK-tagged |
CNY 5890.00 |
|
RC221629L4 | Lenti ORF clone of Human fibroblast growth factor 16 (FGF16), mGFP tagged |
CNY 5890.00 |
|
RG221629 | FGF16 (tGFP-tagged) - Human fibroblast growth factor 16 (FGF16) |
CNY 4000.00 |