FGF16 (NM_003868) Human Untagged Clone

CAT#: SC303395

FGF16 (untagged)-Human fibroblast growth factor 16 (FGF16)



  "NM_003868" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-FGF16 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FGF-16; MF4
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_003868 edited
ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCG
TCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAA
ATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTGAAGGGGATCCTG
CGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACG
GTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCT
GTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGA
GGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAA
GAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAG
TATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACAC
CAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCC
AGAGACCTCTTTCACTATAGGTAA
Restriction Sites Please inquire     
ACCN NM_003868
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003868.1, NP_003859.1
RefSeq Size 624 bp
RefSeq ORF 624 bp
Locus ID 8823
UniProt ID O43320
Protein Families Secreted Protein
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary This gene encodes a member of a family of proteins that are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene is expressed in cardiac cells and is required for proper heart development. Mutation in this gene was also observed in individuals with metacarpal 4-5 fusion. [provided by RefSeq, Mar 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...