TWEAK (TNFSF12) (NM_003809) Human Untagged Clone
CAT#: SC303382
TNFSF12 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | APO3L; DR3LG; TNLG4A; TWEAK |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_003809 edited
CCCATGGCCGCCCGTCGGAGCCAGAGGCGGAGGGGGCGCCGGGGGGAGCCGGGCACCGCC CTGCTGGTCCCGCTCGCGCTGGGCCTGGGCCTGGCGCTGGCCTGCCTCGGCCTCCTGCTG GCCGTGGTCAGTTTGGGGAGCCGGGCATCGCTGTCCGCCCAGGAGCCTGCCCAGGAGGAG CTGGTGGCAGAGGAGGACCAGGACCCGTCGGAACTGAATCCCCAGACAGAAGAAAGCCAG GATCCTGCGCCTTTCCTGAACCGACTAGTTCGGCCTCGCAGAAGTGCACCTAAAGGCCGG AAAACACGGGCTCGAAGAGCGATCGCAGCCCATTATGAAGTTCATCCACGACCTGGACAG GACGGAGCGCAGGCAGGTGTGGACGGGACAGTGAGTGGCTGGGAGGAAGCCAGAATCAAC AGCTCCAGCCCTCTGCGCTACAACCGCCAGATCGGGGAGTTTATAGTCACCCGGGCTGGG CTCTACTACCTGTACTGTCAGGTGCACTTTGATGAGGGGAAGGCTGTCTACCTGAAGCTG GACTTGCTGGTGGATGGTGTGCTGGCCCTGCGCTGCCTGGAGGAATTCTCAGCCACTGCG GCGAGTTCCCTCGGGCCCCAGCTCCGCCTCTGCCAGGTGTCTGGGCTGTTGGCCCTGCGG CCAGGGTCCTCCCTGCGGATCCGCACCCTCCCCTGGGCCCATCTCAAGGCTGCCCCCTTC CTCACCTACTTCGGACTCTTCCAGGTTCACTGAGGGGCCCTGGTCTCCCCGCAGTCGTCC CAGGCTGCCGGCTCCCCTCGACAGCTCTCTGGGCACCCGGTCCCCTCTGCCCCACCCTCA GCCGCTCTTTGCTCCAGACCTGCCCCTCCCTCTAGAGGCTGCCTGGGCCTGTTCACGTGT TTTCCATCCCACATAAATACAGTATTCCCACTCTTATCTTACAACTCCCCCACCGCCCAC TCTCCACCT |
| Restriction Sites | Please inquire |
| ACCN | NM_003809 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003809.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003809.2, NP_003800.1 |
| RefSeq Size | 1407 bp |
| RefSeq ORF | 750 bp |
| Locus ID | 8742 |
| UniProt ID | O43508 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction |
| Gene Summary | The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (1) represents the shorter transcript but encodes the functional protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221007 | TNFSF12 (Myc-DDK-tagged)-Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1 |
CNY 3600.00 |
|
| RC221007L1 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC221007L2 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RC221007L3 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1, Myc-DDK-tagged |
CNY 6000.00 |
|
| RC221007L4 | Lenti ORF clone of Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1, mGFP tagged |
CNY 6000.00 |
|
| RG221007 | TNFSF12 (tGFP-tagged) - Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1 |
CNY 4370.00 |
