WNT9B (NM_003396) Human Untagged Clone
CAT#: SC303299
WNT9B (untagged)-Human wingless-type MMTV integration site family, member 9B (WNT9B)
CNY 3656.00
CNY 5800.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | WNT14B; WNT15 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_003396 edited
TCGCCATGCGCCCCCCGCCCGCGCTGGCCCTGGCCGGGCTCTGCCTGCTGGCGCTGCCCG CCGCCGCCGCCTCCTACTTCGGCCTGACCGGGCGGGAAGTCCTGACGCCCTTCCCAGGAT TGGGCACTGCGGCAGCCCCGGCACAGGGCGGGGCCCACCTGAAGCAGTGTGACCTGCTGA AGCTGTCCCGGCGGCAGAAGCAGCTCTGCCGGAGGGAGCCCGGCCTGGCTGAGACCCTGA GGGATGCTGCGCACCTCGGCCTGCTTGAGTGCCAGTTTCAGTTCCGGCATGAGCGCTGGA ACTGTAGCCTGGAGGGCAGGACGGGCCTGCTCAAGAGAGGCTTCAAAGAGACAGCTTTCC TGTACGCGGTGTCCTCTGCCGCCCTCACCCACACCCTGGCCCGGGCCTGCAGCGCTGGGC GCATGGAGCGCTGCACCTGTGATGACTCTCCGGGGCTGGAGAGCCGGCAGGCCTGGCAGT GGGGCGTGTGCGGTGACAACCTCAAGTACAGCACCAAGTTTCTGAGCAACTTCCTGGGGT CCAAGAGAGGAAACAAGGACCTGCGGGCACGGGCAGACGCCCACAATACCCACGTGGGCA TCAAGGCTGTGAAGAGTGGCCTCAGGACCACGTGTAAGTGCCATGGCGTATCAGGCTCCT GTGCCGTGCGCACCTGCTGGAAGCAGCTCTCCCCGTTCCGTGAGACGGGCCAGGTGCTGA AACTGCGCTATGACTCGGCTGTCAAGGTGTCCAGTGCCACCAATGAGGCCTTGGGCCGCC TAGAGCTGTGGGCCCCTGCCAGGCAGGGCAGCCTCACCAAAGGCCTGGCCCCAAGGTCTG GGGACCTGGTGTACATGGAGGACTCACCCAGCTTCTGCCGGCCCAGCAAGTACTCACCTG GCACAGCAGGTAGGGTGTGCTCCCGGGAGGCCAGCTGCAGCAGCCTGTGCTGCGGGCGGG GCTATGACACCCAGAGCCGCCTGGTGGCCTTCTCCTGCCACTGCCAGGTGCAGTGGTGCT GCTACGTGGAGTGCCAGCAATGTGTGCAGGAGGAGCTTGTGTACACCTGCAAGCACTAGT CTAGA |
Restriction Sites | Please inquire |
ACCN | NM_003396 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_003396.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003396.1, NP_003387.1 |
RefSeq Size | 1464 bp |
RefSeq ORF | 1074 bp |
Locus ID | 7484 |
UniProt ID | O14905 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
Gene Summary | The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
The polycystin complex mediates Wnt/Ca(2+) signalling
,Kim, S;Nie, H;Nesin, V;Tran, U;Outeda, P;Bai, CX;Keeling, J;Maskey, D;Watnick, T;Wessely, O;Tsiokas, L;,
Nat. Cell Biol.
,PubMed ID 27214281
[WNT9B]
|
Characterization of the Interaction of Sclerostin with the Low Density Lipoprotein Receptor-related Protein (LRP) Family of Wnt Co-receptors
,Gill Holdsworth, Patrick Slocombe, Carl Doyle, Bernadette Sweeney, Vaclav Veverka, Kelly Le Riche, Richard J. Franklin, Joanne Compson, Daniel Brookings, James Turner, Jeffery Kennedy, Rachael Garlish, Jiye Shi, Laura Newnham, David McMillan, Mariusz Muzylak, Mark D. Carr, Alistair J. Henry, Thomas Ceska, and Martyn K. Robinson,
J. Biol. Chem., Aug 2012; 287: 26464 - 26477.
[WNT9B]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212746 | WNT9B (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 9B (WNT9B) |
CNY 3656.00 |
|
RC212746L1 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 9B (WNT9B), Myc-DDK-tagged |
CNY 6056.00 |
|
RC212746L2 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 9B (WNT9B), mGFP tagged |
CNY 5890.00 |
|
RC212746L3 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 9B (WNT9B), Myc-DDK-tagged |
CNY 6056.00 |
|
RC212746L4 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 9B (WNT9B), mGFP tagged |
CNY 6056.00 |
|
RG212746 | WNT9B (tGFP-tagged) - Human wingless-type MMTV integration site family, member 9B (WNT9B) |
CNY 5256.00 |