SULT2A1 (NM_003167) Human Untagged Clone
CAT#: SC303280
SULT2A1 (untagged)-Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (SULT2A1)
CNY 2400.00
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DHEA-ST; DHEA-ST8; DHEAS; HST; hSTa; ST2; ST2A1; ST2A3; STD; SULT2A3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_003167 edited
ATGTCGGACGATTTCTTATGGTTTGAAGGCATAGCTTTCCCTACTATGGGTTTCAGATCC GAAACCTTAAGAAAAGTACGTGATGAGTTCGTGATAAGGGATGAAGATGTAATAATATTG ACTTACCCCAAATCAGGAACAAACTGGTTGGCTGAGATTCTCTGCCTGATGCACTCCAAG GGGGATGCCAAGTGGATCCAATCTGTGCCCATCTGGGAGCGATCACCCTGGGTAGAGAGT GAGATTGGGTATACAGCACTCAGTGAAACGGAGAGTCCACGTTTATTCTCCTCCCACCTC CCCATCCAGTTATTCCCCAAGTCTTTCTTCAGTTCCAAGGCCAAGGTGATTTATCTCATG AGAAATCCCAGAGATGTTTTGGTGTCTGGTTATTTTTTCTGGAAAAACATGAAGTTTATT AAGAAACCAAAGTCATGGGAAGAATATTTTGAATGGTTTTGTCAAGGAACTGTGCTATAT GGGTCATGGTTTGACCACATTCATGGCTGGATGCCCATGAGAGAGGAGAAAAACTTCCTG TTACTGAGTTATGAGGAGCTGAAACAGGACACAGGAAGAACCATAGAGAAGATCTGTCAA TTCCTGGGAAAGACGTTAGAACCCGAAGAACTGAACTTAATTCTCAAGAACAGCTCCTTT CAGAGCATGAAAGAAAACAAGATGTCCAATTATTCCCTCCTGAGTGTTGATTATGTAGTG GACAAAGCACAACTTCTGAGAAAAGGTGTATCTGGGGACTGGAAAAATCACTTCACAGTG GCCCAAGCTGAAGACTTTGATAAATTGTTCCAAGAGAAGATGGCAGATCTTCCTCGAGAG CTGTTCCCATGGGAATAA |
Restriction Sites | Please inquire |
ACCN | NM_003167 |
Insert Size | 1000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_003167.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003167.2, NP_003158.2 |
RefSeq Size | 1779 bp |
RefSeq ORF | 858 bp |
Locus ID | 6822 |
UniProt ID | Q06520 |
Gene Summary | This gene encodes a member of the sulfotransferase family. Sulfotransferases aid in the metabolism of drugs and endogenous compounds by converting these substances into more hydrophilic water-soluble sulfate conjugates that can be easily excreted. This protein catalyzes the sulfation of steroids and bile acids in the liver and adrenal glands, and may have a role in the inherited adrenal androgen excess in women with polycystic ovary syndrome. [provided by RefSeq, Mar 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204737 | SULT2A1 (Myc-DDK-tagged)-Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (SULT2A1) |
CNY 2400.00 |
|
RC204737L3 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (SULT2A1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC204737L4 | Lenti ORF clone of Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (SULT2A1), mGFP tagged |
CNY 5890.00 |
|
RG204737 | SULT2A1 (tGFP-tagged) - Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 (SULT2A1) |
CNY 4000.00 |
其它SULT2A1产品