SHOX2 (NM_003030) Human Untagged Clone
CAT#: SC303264
SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2), transcript variant 1
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OG12; OG12X; SHOT |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_003030, the custom clone sequence may differ by one or more nucleotides
ATGGAAGAACTTACGGCGTTCGTCTCCAAGTCTTTTGACCAGAAAGTGAAGGAGAAGAAG GAGGCGATCACGTACCGGGAGGTGCTGGAGAGCGGGCCGCTGCGCGGGGCCAAGGAGCCG ACCGGCTGCACCGAGGCGGGCCGCGACGACCGCAGCAGCCCGGCAGTCCGGGCGGCCGGC GGAGGCGGCGGCGGAGGAGGCGGAGGCGGCGGCGGAGGAGGCGGAGGAGGTGTAGGAGGA GGAGGAGCAGGCGGAGGAGCTGGAGGAGGGCGCTCTCCCGTCCGGGAGCTGGACATGGGC GCCGCCGAGAGAAGCAGGGAGCCGGGCAGCCCGCGACTGACGGAGGGTAGAAGGAAGCCA ACGAAAGCTGAGGTCCAGGCTACGCTGCTTCTCCCGGGCGAGGCGTTTCGGTTTCTTGTG TCCCCGGAGCTGAAAGATCGCAAAGAGGATGCGAAAGGGATGGAGGACGAAGGCCAGACC AAAATCAAGCAGAGGCGAAGTCGGACCAATTTCACCCTGGAACAACTCAATGAGCTGGAG AGGCTTTTTGACGAGACCCACTATCCCGACGCCTTCATGCGAGAGGAACTGAGCCAGCGA CTGGGCCTGTCGGAGGCCCGAGTGCAGGTTTGGTTTCAAAATCGAAGAGCTAAATGTAGA AAACAAGAAAATCAACTCCATAAAGGTGTTCTCATAGGGGCCGCCAGCCAGTTTGAAGCT TGTAGAGTCGCACCTTATGTCAACGTAGGTGCTTTAAGGATGCCATTTCAGCAGGATAGT CATTGCAACGTGACGCCCTTGTCCTTTCAGGTTCAGGCGCAGCTGCAGCTGGACAGCGCT GTGGCGCACGCGCACCACCACCTGCATCCGCACCTGGCCGCGCACGCGCCCTACATGATG TTCCCAGCACCGCCCTTCGGACTGCCGCTCGCCACGCTGGCCGCGGATTCGGCTTCCGCC GCCTCGGTAGTGGCGGCCGCAGCAGCCGCCAAGACCACCAGCAAGAACTCCAGCATCGCC GATCTCAGACTGAAAGCCAAAAAGCACGCCGCAGCCCTGGGTCTGTGA |
Restriction Sites | Please inquire |
ACCN | NM_003030 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003030.2, NP_003021.1 |
RefSeq Size | 1696 bp |
RefSeq ORF | 573 bp |
Locus ID | 6474 |
UniProt ID | O60902 |
Protein Families | Transcription Factors |
Gene Summary | This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220580 | SHOX2 (Myc-DDK-tagged)-Human short stature homeobox 2 (SHOX2), transcript variant 1 |
CNY 3990.00 |
|
RC220580L3 | Lenti-ORF clone of SHOX2 (Myc-DDK-tagged)-Human short stature homeobox 2 (SHOX2), transcript variant 1 |
CNY 5890.00 |
|
RC220580L4 | Lenti-ORF clone of SHOX2 (mGFP-tagged)-Human short stature homeobox 2 (SHOX2), transcript variant 1 |
CNY 5890.00 |
|
RG220580 | SHOX2 (tGFP-tagged) - Human short stature homeobox 2 (SHOX2), transcript variant 1 |
CNY 5624.00 |
|
SC327806 | SHOX2 (untagged)-Human short stature homeobox 2 (SHOX2) transcript variant 1 |
CNY 7220.00 |