MSI1 (NM_002442) Human Untagged Clone

CAT#: SC303202

MSI1 (untagged)-Human musashi homolog 1 (Drosophila) (MSI1)



  "NM_002442" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
MSI1 mouse monoclonal antibody, clone OTI1G8 (formerly 1G8)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_002442 edited
CGCCGCCCGCGGCTCCCGATGGAGACTGACGCGCCCCAGCCCGGCCTCGCCTCCCCGGAC
TCGCCGCACGACCCCTGCAAGATGTTCATCGGGGGACTCAGTTGGCAGACTACGCAGGAA
GGGCTGCGCGAATACTTCGGCCAGTTCGGGGAGGTGAAGGAGTGTCTGGTGATGCGGGAC
CCCCTGACCAAGAGATCCAGGGGTTTCGGCTTCGTCACTTTCATGGACCAGGCGGGGGTG
GATAAAGTGCTGGCGCAATCGCGGCACGAGCTCGACTCCAAAACAATTGACCCTAAGGTG
GCCTTCCCTCGGCGAGCACAGCCCAAGATGGTGACTCGAACGAAGAAGATCTTTGTGGGG
GGGCTGTCGGTGAACACCACGGTGGAGGACGTGAAGCAATATTTTGAGCAGTTTGGGAAG
GTGGACGACGCCATGCTGATGTTTGACAAAACCACCAACCGGCACCGAGGGTTCGGGTTT
GTCACGTTTGAGAGTGAGGACATCGTGGAGAAAGTGTGTGAAATTCATTTTCATGAAATC
AACAACAAAATGGTGGAATGTAAGAAAGCTCAGCCAAAGGAGGTGATGTCGCCAACGGGC
TCAGCCCGGGGGAGGTCTCGAGTCATGCCCTACGGAATGGACGCCTTCATGCTGGGCATC
GGCATGCTGGGTTACCCAGGTTTCCAAGCCACAACCTACGCCAGCCGGAGTTATACAGGC
CTCGCCCCTGGCTACACCTACCAGTTCCCCGAATTCCGTGTAGAGCGGACCCCTCTCCCG
AGCGCCCCAGTCCTCCCCGAGCTTACAGCCATTCCTCTCACTGCCTACGGACCAATGGCG
GCGGCAGCGGCGGCAGCGGCTGTGGTTCGAGGGACAGGCTCTCACCCCTGGACGATGGCT
CCCCCTCCAGGTTCGACTCCCAGCCGCACAGGGGGCTTCCTGGGGACCACCAGCCCCGGC
CCCATGGCCGAGCTCTACGGGGCGGCCAACCAGGACTCGGGGGTCAGCAGTTACATCAGC
GCCGCCAGCCCTGCCCCCAGCACCGGCTTCGGCCACAGTCTTGGGGGCCCTTTGATTGCC
ACAGCCTTCACCAATGGGTACCACTGAAG
Restriction Sites Please inquire     
ACCN NM_002442
Insert Size 1100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002442.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002442.2, NP_002433.1
RefSeq Size 2950 bp
RefSeq ORF 1089 bp
Locus ID 4440
UniProt ID O43347
Gene Summary This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Expression of this gene has been correlated with the grade of the malignancy and proliferative activity in gliomas and melanomas. A pseudogene for this gene is located on chromosome 11q13. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...