MAGEB1 (NM_002363) Human Untagged Clone

CAT#: SC303186

MAGEB1 (untagged)-Human melanoma antigen family B, 1 (MAGEB1), transcript variant 1



  "NM_002363" in other vectors (6)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MAGEB1 mouse monoclonal antibody, clone OTI4E12 (formerly 4E12)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT3.1; DAM10; MAGE-Xp; MAGEL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC303186 representing NM_002363.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTCGGGGTCAGAAGAGTAAGCTCCGTGCTCGTGAGAAACGCCGCAAGGCGCGAGAGGAGACCCAG
GGTCTCAAGGTTGCTCACGCCACTGCAGCAGAGAAAGAGGAGTGCCCCTCCTCCTCTCCTGTTTTAGGG
GATACTCCCACAAGCTCCCCTGCTGCTGGCATTCCCCAGAAGCCTCAGGGAGCTCCACCCACCACCACT
GCTGCTGCAGCTGTGTCATGTACCGAATCTGACGAAGGTGCCAAATGCCAAGGTGAGGAAAATGCAAGT
TTCTCCCAGGCCACAACATCCACTGAGAGCTCAGTCAAAGATCCTGTAGCCTGGGAGGCAGGAATGCTG
ATGCACTTCATTCTACGTAAGTATAAAATGAGAGAGCCCATTATGAAGGCAGATATGCTGAAGGTTGTT
GATGAAAAGTACAAGGATCACTTCACTGAGATCCTCAATGGAGCCTCTCGCCGCTTGGAGCTCGTCTTT
GGCCTTGATTTGAAGGAAGACAACCCTAGTGGCCACACCTACACCCTCGTCAGTAAGCTAAACCTCACC
AATGATGGAAACCTGAGCAATGATTGGGACTTTCCCAGGAATGGGCTTCTGATGCCTCTCCTGGGTGTG
ATCTTCTTAAAGGGCAACTCTGCCACCGAGGAAGAGATCTGGAAATTCATGAATGTGTTGGGAGCCTAT
GATGGAGAGGAGCACTTAATCTATGGGGAACCCCGTAAGTTCATCACCCAAGATCTGGTGCAGGAAAAA
TATCTGAAGTACGAGCAGGTGCCCAACAGTGATCCCCCACGCTATCAATTCCTATGGGGTCCGAGAGCC
TATGCTGAAACCACCAAGATGAAAGTCCTCGAGTTTTTGGCCAAGATGAATGGTGCCACTCCCCGTGAC
TTCCCATCCCATTATGAAGAGGCTTTGAGAGATGAGGAAGAGAGAGCCCAAGTCCGATCCAGTGTTAGA
GCCAGGCGTCGCACTACTGCCACGACTTTTAGAGCGCGTTCTAGAGCCCCATTCAGCAGGTCCTCCCAC
CCCATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_002363
Insert Size 1044 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002363.4
RefSeq Size 1865 bp
RefSeq ORF 1044 bp
Locus ID 4112
UniProt ID P43366
MW 39 kDa
Gene Summary This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region, and expressed in testis and in a significant fraction of tumors of various histological types. This gene and other MAGEB members are clustered on chromosome Xp22-p21. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene, however, the full length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) is the longest transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...