NKG2A (KLRC1) (NM_002259) Human Untagged Clone
CAT#: SC303158
KLRC1 (untagged)-Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD159A; NKG2; NKG2A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC303158 representing NM_002259.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATAACCAAGGAGTAATCTACTCAGACCTGAATCTGCCCCCAAACCCAAAGAGGCAGCAACGAAAA CCTAAAGGCAATAAAAGCTCCATTTTAGCAACTGAACAGGAAATAACCTATGCGGAATTAAACCTTCAA AAAGCTTCTCAGGATTTTCAAGGGAATGACAAAACCTATCACTGCAAAGATTTACCATCAGCTCCAGAG AAGCTCATTGTTGGGATCCTGGGAATTATCTGTCTTATCTTAATGGCCTCTGTGGTAACGATAGTTGTT ATTCCCTCTACATTAATACAGAGGCACAACAATTCTTCCCTGAATACAAGAACTCAGAAAGCACGTCAT TGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTACTACATTGGTAAGGAAAGAAGA ACTTGGGAAGAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAA GAAATGAAATTTCTGTCCATCATTTCACCATCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCAT CCATGGGTGACAATGAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATAATGCTGAACTTAAC TGTGCAGTGCTACAAGTAAATCGACTTAAATCAGCCCAGTGTGGATCTTCAATAATATATCATTGTAAG CATAAGCTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002259 |
Insert Size | 702 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002259.4 |
RefSeq Size | 1443 bp |
RefSeq ORF | 702 bp |
Locus ID | 3821 |
UniProt ID | P26715 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Graft-versus-host disease, Natural killer cell mediated cytotoxicity |
MW | 26.3 kDa |
Gene Summary | Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (1) encodes the longer isoform (NKG2-A). Variants 1 and 3 encode the same isoform (NKG2-A). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208585 | KLRC1 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1 |
CNY 2400.00 |
|
RC208585L1 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC208585L2 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
RC208585L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC208585L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
RG208585 | KLRC1 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1 |
CNY 4000.00 |
|
SC320997 | KLRC1 (untagged)-Human killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant 1 |
CNY 2400.00 |