CD161 (KLRB1) (NM_002258) Human Untagged Clone
CAT#: SC303157
KLRB1 (untagged)-Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD161; CLEC5B; hNKR-P1A; NKR; NKR-P1; NKR-P1A; NKRP1A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303157 representing NM_002258.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACCAACAAGCAATATATGCTGAGTTAAACTTACCCACAGACTCAGGCCCAGAAAGTTCTTCACCT TCATCTCTTCCTCGGGATGTCTGTCAGGGTTCACCTTGGCATCAATTTGCCCTGAAACTTAGCTGTGCT GGGATTATTCTCCTTGTCTTGGTTGTTACTGGGTTGAGTGTTTCAGTGACATCCTTAATACAGAAATCA TCAATAGAAAAATGCAGTGTGGACATTCAACAGAGCAGGAATAAAACAACAGAGAGACCGGGTCTCTTA AACTGCCCAATATATTGGCAGCAACTCCGAGAGAAATGCTTGTTATTTTCTCACACTGTCAACCCTTGG AATAACAGTCTAGCTGATTGTTCCACCAAAGAATCCAGCCTGCTGCTTATTCGAGATAAGGATGAATTG ATACACACACAGAACCTGATACGTGACAAAGCAATTCTGTTTTGGATTGGATTAAATTTTTCATTATCA GAAAAGAACTGGAAGTGGATAAACGGCTCTTTTTTAAATTCTAATGACTTAGAAATTAGAGGTGATGCT AAAGAAAACAGCTGTATTTCCATCTCACAGACATCTGTGTATTCTGAGTACTGTAGTACAGAAATCAGA TGGATCTGCCAAAAAGAACTAACACCTGTGAGAAATAAAGTGTATCCTGACTCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_002258 |
| Insert Size | 678 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002258.2 |
| RefSeq Size | 740 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 3820 |
| UniProt ID | Q12918 |
| Protein Families | Transmembrane |
| MW | 25.4 kDa |
| Gene Summary | Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216459 | KLRB1 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1) |
CNY 2400.00 |
|
| RC216459L1 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC216459L2 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1), mGFP tagged |
CNY 5890.00 |
|
| RC216459L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC216459L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1), mGFP tagged |
CNY 4800.00 |
|
| RG216459 | KLRB1 (tGFP-tagged) - Human killer cell lectin-like receptor subfamily B, member 1 (KLRB1) |
CNY 4000.00 |
