HOXA4 (NM_002141) Human Untagged Clone
CAT#: SC303125
HOXA4 (untagged)-Human homeobox A4 (HOXA4)
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HOX1; HOX1D |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_002141 edited
ATTAATGACCATGAGCTCGTTTTTGATAAACTCCAACTACATCGAGCCCAAGTTCCCTCC CTTCGAGGAGTACGCGCAGCACAGCGGCTCGGGCGGCGCAGACGGCGGCCCGGGCGGGGG CCCCGGCTACCAGCAGCCCCCAGCGCCCCCGACCCAGCACCTGCCGCTGCAGCAGCCCCA GCTCCCTCACGCGGGCGGCGGCCGAGAGCCCCCTGCCTCCTACTACGCGCCGCGGACCGC CCGCGAGCCCGCCTACCCTGCTGCCGCGCTGTACCCCGCGCATGGGGCCGCGGACACCGC CTACCCCTATGGCTACCGCGGCGGCGCCAGCCCCGGGCGGCCGCCCCAGCCCGAGCAGCC CCCGGCGCAAGCCAAGGGCCCAGCGCACGGCCTGCATGCGAGCCACGTCCTGCAGCCCCA GCCGCCGCCGCCCCTGCAGCCTCGCGCCGTGCCCCCAGCGGCCCCGCGGCGCTGCGAGGC GGCCCCCGCCACCCCAGGCGTCCCGGCAGGGGGCAGCGCCCCCGCGTGCCCGCTGCTCTT GGCCGACAAGAGCCCGCTGGGCCTGAAGGGCAAGGAGCCCGTGGTGTACCCCTGGATGAA GAAGATCCATGTCAGCGCCGTTAACCCCAGTTATAACGGAGGGGAGCCTAAGCGCTCTCG AACCGCCTACACCCGGCAGCAGGTCTTGGAGCTGGAGAAGGAGTTCCACTTCAATCGCTA CCTGACCCGGCGGCGCCGCATCGAGATCGCCCACACGCTCTGTTTGTCTGAGCGCCAGGT CAAGATCTGGTTTCAGAACCGGAGGATGAAGTGGAAGAAAGACCACAAACTGCCCAACAC CAAGATGCGATCCTCCAATTCGGCCTCGGCCTCTGCCGGCCCACCAGGGAAAGCACAAAC TCAGAGCCCACACCTCCATCCCCACCCCCACCCGAGCACCTCCACACCCGTTCCCTCCTC CATATAATCTTCTAGAGATCTTAACCAGTTTCTATCCCTTACCTGC |
| Restriction Sites | Please inquire |
| ACCN | NM_002141 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002141.3, NP_002132.2 |
| RefSeq Size | 1844 bp |
| RefSeq ORF | 1728 bp |
| Locus ID | 3201 |
| UniProt ID | Q00056 |
| Protein Families | Transcription Factors |
| Gene Summary | In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213447 | HOXA4 (Myc-DDK-tagged)-Human homeobox A4 (HOXA4) |
CNY 2400.00 |
|
| RC213447L3 | Lenti-ORF clone of HOXA4 (Myc-DDK-tagged)-Human homeobox A4 (HOXA4) |
CNY 5890.00 |
|
| RC213447L4 | Lenti-ORF clone of HOXA4 (mGFP-tagged)-Human homeobox A4 (HOXA4) |
CNY 5890.00 |
|
| RG213447 | HOXA4 (tGFP-tagged) - Human homeobox A4 (HOXA4) |
CNY 4370.00 |
