GTF3A (NM_002097) Human Untagged Clone

CAT#: SC303118

GTF3A (untagged)-Human general transcription factor IIIA (GTF3A)



  "NM_002097" in other vectors (4)

CNY 5990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GTF3A rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AP2; TFIIIA
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_002097 edited
CTGGATCCGCCGGCCGTGGTCGCCGAGTCGGTGTCGTCCTTGACCATCGCCGACGCGTTC
ATTGCAGCCGGCGAGAGCTCAGCTCCGACCCCGCCGCGCCCCGCGCTTCCCAGGAGGTTC
ATCTGCTCCTTCCCTGACTGCAGCGCCAATTACAGCAAAGCCTGGAAGCTTGACGCGCAC
CTGTGCAAGCACACGGGGGAGAGACCATTTGTTTGTGACTATGAAGGGTGTGGCAAGGCC
TTCATCAGGGACTACCATCTGAGCCGCCACATTCTGACTCACACAGGAGAAAAGCCGTTT
GTTTGTGCAGCCAATGGCTGTGATCAAAAATTCAACACAAAATCAAACTTGAAGAAACAT
TTTGAACGCAAACATGAAAATCAACAAAAACAATATATATGCAGTTTTGAAGACTGTAAG
AAGACCTTTAAGAAACATCAGCAGCTGAAAATCCATCAGTGCCAGCATACCAATGAACCT
CTATTCAAGTGTACCCAGGAAGGATGTGGGAAACACTTTGCATCACCCAGCAAGCTGAAA
CGACATGCCAAGGCCCACGAGGGCTATGTATGTCAAAAAGGATGTTCCTTTGTGGCAAAA
ACATGGACGGAACTTCTGAAACATGTGAGAGAAACCCATAAAGAGGAAATACTATGTGAA
GTATGCCGGAAAACATTTAAACGCAAAGATTACCTTAAGCAACACATGAAAACTCATGCC
CCAGAAAGGGATGTATGTCGCTGTCCAAGAGAAGGCTGTGGAAGAACCTATACAACTGTG
TTTAATCTCCAAAGCCATATCCTCTCCTTCCATGAGGAAAGCCGCCCTTTTGTGTGTGAA
CATGCTGGCTGTGGCAAAACATTTGCAATGAAACAAAGTCTCACTAGGCATGCTGTTGTA
CATGATCCTGACAAGAAGAAAATGAAGCTCAAAGTCAAAAAATCTCGTGAAAAACGGAGT
TTGGCCTCTCATCTCAGTGGATATATCCCTCCCAAAAGGAAACAAGGGCAAGGCTTATCT
TTGTGTCAAAACGGAGAGTCACCCAACTGTGTGGAAGACAAGATGCTCTCGACAGTTGCA
GTACTTACCCTTGGCTAA
Restriction Sites Please inquire     
ACCN NM_002097
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002097.1, NP_002088.1
RefSeq Size 1381 bp
RefSeq ORF 1272 bp
Locus ID 2971
UniProt ID Q92664
Protein Families Transcription Factors
Gene Summary The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...