GPX5 (NM_001509) Human Untagged Clone
CAT#: SC303037
GPX5 (untagged)-Human glutathione peroxidase 5 (epididymal androgen-related protein) (GPX5), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EGLP; GPx-5; GSHPx-5; HEL-S-75p |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001509 edited
GCCGCCACCATGACTACACAGTTAAGGGTCGTCCATCTGCTTCCCCTTCTCCTAGCCTGC TTTGTGCAAACAAGTCCCAAGCAGGAGAAGATGAAGATGGATTGCCACAAAGACGAGAAA GGCACCATCTATGACTATGAGGCCATCGCACTTAATAAGAATGAATATGTTTCCTTCAAG CAGTATGTGGGCAAGCACATCCTCTTCGTCAACGTGGCCACCTACTGTGGTCTGACAGCG CAATATCCTGAACTAAATGCACTCCAGGAGGAGCTGAAGCCCTATGGTCTAGTTGTGTTG GGCTTTCCCTGCAACCAATTTGGAAAGCAAGAACCAGGAGATAACAAAGAGATTCTTCCT GGGCTCAAGTATGTCCGTCCAGGGGGAGGATTTGTACCTAGTTTCCAGCTTTTTGAGAAA GGGGATGTGAATGGTGAAAAAGAACAGAAAGTCTTCAGTTTCTTGAAGCACTCCTGTCCT CATCCCTCTGAGATTTTGGGCACATTCAAATCTATATCCTGGGACCCTGTAAAGGTCCAT GACATCCGTTGGAACTTTGAAAAGTTCCTGGTGGGGCCTGATGGAATCCCTGTCATGCGC TGGTCCCACCGGGCTACGGTCAGCTCAGTCAAGACAGACATCCTGGCGTACTTGAAGCAA TTCAAAACCAAATAG |
Restriction Sites | Please inquire |
ACCN | NM_001509 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001509.1, NP_001500.1 |
RefSeq Size | 668 bp |
RefSeq ORF | 666 bp |
Locus ID | 2880 |
UniProt ID | O75715 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Arachidonic acid metabolism, Glutathione metabolism |
Gene Summary | This gene belongs to the glutathione peroxidase family. It is specifically expressed in the epididymis in the mammalian male reproductive tract, and is androgen-regulated. Unlike several other characterized glutathione peroxidases, this enzyme is not a selenoprotein, lacking the selenocysteine residue. Thus, it is selenium-independent, and has been proposed to play a role in protecting the membranes of spermatozoa from the damaging effects of lipid peroxidation and/or preventing premature acrosome reaction. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2016] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220321 | GPX5 (Myc-DDK-tagged)-Human glutathione peroxidase 5 (epididymal androgen-related protein) (GPX5), transcript variant 1 |
CNY 2400.00 |
|
RC220321L3 | Lenti ORF clone of Human glutathione peroxidase 5 (epididymal androgen-related protein) (GPX5), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC220321L4 | Lenti ORF clone of Human glutathione peroxidase 5 (epididymal androgen-related protein) (GPX5), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG220321 | GPX5 (tGFP-tagged) - Human glutathione peroxidase 5 (epididymal androgen-related protein) (GPX5), transcript variant 1 |
CNY 4370.00 |