Aquaporin 7 (AQP7) (NM_001170) Human Untagged Clone
CAT#: SC302983
AQP7 (untagged)-Human aquaporin 7 (AQP7)
CNY 5,488.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AQP7L; AQPap; GLYCQTL |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001170 edited
ATGGTTCAAGCATCCGGGCACAGGCGGTCCACCCGTGGCTCCAAAATGGTCTCCTGGTCC GTGATAGCAAAGATCCAGGAAATACTGCAGAGGAAGATGGTGCGAGAGTTCCTGGCCGAG TTCATGAGCACATATGTCATGATGGTATTCGGCCTTGGTTCCGTGGCCCATATGGTTCTA AATAAAAAATATGGGAGCTACCTTGGTGTCAACTTGGGTTTTGGCTTCGGAGTCACCATG GGAGTGCACGTGGCAGGCCGCATCTCTGGAGCCCACATGAACGCAGCTGTGACCTTTGCT AACTGTGCGCTGGGCCGCGTGCCCTGGAGGAAGTTTCCGGTCTATGTGCTGGGGCAGTTC CTGGGCTCCTTCCTGGCGGCTGCCACCATCTACAGTCTCTTCTACACGGCCATTCTCCAC TTTTCGGGTGGACAGCTGATGGTGACCGGTCCCGTCGCTACAGCTGGCATTTTTGCCACC TACCTTCCTGATCACATGACATTGTGGCGGGGCTTCCTGAATGAGGCGTGGCTGACCGGG ATGCTCCAGCTGTGTCTCTTCGCCATCACGGACCAGGAGAACAACCCAGCACTGCCAGGA ACAGAGGCGCTGGTGATAGGCATCCTCGTGGTCATCATCGGGGTGTCCCTTGGCATGAAC ACAGGATATGCCATCAACCCGTCCCGGGACCTGCCCCCCCGCATCTTCACCTTCATTGCT GGTTGGGGCAAACAGGTCTTCAGCAATGGGGAGAACTGGTGGTGGGTGCCAGTGGTGGCA CCACTTCTGGGTGCCTATCTAGGTGGCATCATCTACCTGGTCTTCATTGGCTCCACCATC CCACGGGAGCCCCTGAAATTGGAGGATTCTGTGGCGTATGAAGACCACGGGATAACCGTA TTGCCCAAGATGGGATCTCATGAACCCACGATCTCTCCCCTCACCCCCGTCTCTGTGAGC CCTGCCAACAGATCTTCAGTCCACCCTGCCCCACCCTTACATGAATCCATGGCCCTAGAG CACTTCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001170 |
Insert Size | 1000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001170.1, NP_001161.1 |
RefSeq Size | 1258 bp |
RefSeq ORF | 1029 bp |
Locus ID | 364 |
UniProt ID | O14520 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | PPAR signaling pathway |
Gene Summary | This gene encodes a member of the aquaporin family of water-selective membrane channels. The encoded protein localizes to the plasma membrane and allows movement of water, glycerol and urea across cell membranes. This gene is highly expressed in the adipose tissue where the encoded protein facilitates efflux of glycerol. In the proximal straight tubules of kidney, the encoded protein is localized to the apical membrane and prevents excretion of glycerol into urine. The encoded protein is present in spermatids, as well as in the testicular and epididymal spermatozoa suggesting an important role in late spermatogenesis. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related aquaporin gene on chromosome 9. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212363 | AQP7 (Myc-DDK-tagged)-Human aquaporin 7 (AQP7) |
CNY 5,488.00 |
|
RC212363L3 | Lenti ORF clone of Human aquaporin 7 (AQP7), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212363L4 | Lenti ORF clone of Human aquaporin 7 (AQP7), mGFP tagged |
CNY 5,890.00 |
|
RG212363 | AQP7 (tGFP-tagged) - Human aquaporin 7 (AQP7) |
CNY 7,088.00 |
其它Aquaporin 7产品