NARF (NM_001038618) Human Untagged Clone

CAT#: SC302951

NARF (untagged)-Human nuclear prelamin A recognition factor (NARF), transcript variant 3



  "NM_001038618" in other vectors (4)

CNY 6460.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NARF rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IOP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302951 representing NM_001038618.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTGCAGAGGAAGGAGTCCAACTTTCCCAGCAAAATGCCAAGGACTTCTTCCGCGTTCTGAACCTT
AACAAGAAATGTGATACCTCAAAGCACAAAGTGCTGGTAGTGTCTGTGTGTCCTCAATCTTTGCCTTAT
TTTGCTGCTAAATTCAACCTCAGTGTAACTGATGCATCCAGAAGACTCTGTGGTTTCCTCAAAAGTCTT
GGGGTGCACTATGTATTTGATACGACGATAGCTGCGGATTTTAGTATCCTGGAGAGTCAAAAAGAATTC
GTGCGTCGCTATCGCCAGCACAGTGAGGAGGAACGCACCCTGCCCATGCTGACCTCTGCCTGTCCTGGC
TGGGTCCGATACGCCGAGCGGGTGCTGGGTCGCCCCATCACTGCCCACCTCTGCACCGCCAAGTCCCCC
CAGCAGGTCATGGGCTCTTTGGTGAAGGATTATTTCGCCAGACAGCAGAACCTGTCTCCAGAGAAGATT
TTCCACGTCATTGTGGCCCCTTGTTATGACAAGAAGCTGGAGGCTCTTCAGGAAAGCCTTCCCCCTGCT
TTGCATGGCTCCCGGGGCGCTGACTGCGTGTTAACATCAGGTGAAATTGCTCAAATAATGGAGCAAGGT
GACCTCTCAGTGAGAGATGCTGCCGTCGACACTCTGTTTGGAGACTTGAAGGAGGACAAAGTGACGCGT
CATGATGGAGCCAGCTCAGACGGGCACCTGGCACACATCTTCAGACATGCGGCCAAGGAGCTGTTCAAC
GAGGATGTGGAGGAGGTCACTTACCGAGCCCTGAGAAACAAAGACTTCCAAGAGGTCACCCTTGAGAAG
AACGGAGAGGTGGTGTTACGCTTTGCTGCAGCCTATGGCTTTCGAAACATCCAGAACATGATCCTGAAG
CTTAAGAAGGGCAAGTTCCCATTCCACTTTGTGGAGGTCCTCGCCTGTGCTGGAGGATGCTTAAATGGC
AGAGGCCAAGCCCAGACTCCAGACGGACATGCGGATAAGGCCCTGCTGCGGCAGATGGAAGGCATTTAC
GCTGACATCCCTGTGCGGCGTCCGGAGTCCAGTGCACACGTGCAGGAGCTGTACCAGGAGTGGCTGGAG
GGGATCAACTCCCCCAAGGCCCGAGAGGTGCTGCATACCACGTACCAGAGCCAGGAGCGTGGCACACAC
AGCCTGGACATCAAGTGGTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001038618
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001038618.2
RefSeq Size 1796 bp
RefSeq ORF 1194 bp
Locus ID 26502
UniProt ID Q9UHQ1
MW 44.7 kDa
Gene Summary Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) contains a distinct 5' end exon compared to transcript variant 1, resulting in translation initiation from an in-frame downstream AUG, and an isoform (c) with a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...