HEPN1 (NM_001037558) Human Untagged Clone
CAT#: SC302914
HEPN1 (untagged)-Human hepatocellular carcinoma, down-regulated 1 (HEPN1)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | cancer susceptibility gene HEPN1; HEPACAM opposite strand 1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302914 representing NM_001037558.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTAACTGGGGCCTTGGAATTGCTCCATGGGTTGATGGCGAATCAGAGCTGGAGTTTAGGAGACTA GGGATGCAAGGACCCTTGGAGGCATTAAGGAGGAGGGAATGGAATACACAGAGGGCCTCCTTCTCTTTC AGCTTTTTAATTGCCCTCTCTCCTCACACAGTAGATTACTGCCACTCCTATGAACTGTTCAATAGGCGG TGGCATGGGCATGTCCTGGCTACACAGCGGCCCAGCCTCTTTATTTTGATGTTAGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037558 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037558.2 |
RefSeq Size | 1428 bp |
RefSeq ORF | 267 bp |
Locus ID | 641654 |
UniProt ID | Q6WQI6 |
MW | 10.3 kDa |
Gene Summary | This gene is expressed predominantly in the liver. Transient transfection studies show the expression of this gene significantly inhibits cell growth, suggesting a role for this gene in apoptosis. Expression of this gene is down-regulated or lost in hepatocellular carcinomas (HCC), suggesting that loss of this gene is involved in carcinogenesis of hepatocytes (PMID:12971969). This gene maps to the 3'-noncoding region of the HEPACAM gene (GeneID:220296) on the antisense strand. [provided by RefSeq, Aug 2020] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217514 | HEPN1 (Myc-DDK-tagged)-Human hepatocellular carcinoma, down-regulated 1 (HEPN1) |
CNY 1200.00 |
|
RC217514L3 | Lenti ORF clone of Human hepatocellular carcinoma, down-regulated 1 (HEPN1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC217514L4 | Lenti ORF clone of Human hepatocellular carcinoma, down-regulated 1 (HEPN1), mGFP tagged |
CNY 5890.00 |
|
RG217514 | HEPN1 (tGFP-tagged) - Human hepatocellular carcinoma, down-regulated 1 (HEPN1) |
CNY 4370.00 |