PHYH (NM_001037537) Human Untagged Clone
CAT#: SC302910
PHYH (untagged)-Human phytanoyl-CoA 2-hydroxylase (PHYH), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | LN1; LNAP1; PAHX; PHYH1; RD |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302910 representing NM_001037537.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGAGATGTGACCATTTCGAAATCCGAATATGCTCCAAGTGAGAAGATGATCACGAAGGTCCAGGAT TTCCAGGAAGATAAGGAGCTCTTCAGATACTGCACTCTCCCCGAGATTCTGAAATATGTGGAGTGCTTC ACTGGACCTAATATTATGGCCATGCACACAATGTTGATAAACAAACCTCCAGATTCTGGCAAGAAGACG TCCCGTCACCCCCTGCACCAGGACCTGCACTATTTCCCCTTCAGGCCCAGCGATCTCATCGTTTGCGCC TGGACGGCGATGGAGCACATCAGCCGGAACAACGGCTGTCTGGTTGTGCTCCCAGGCACACACAAGGGC TCCCTGAAGCCCCACGATTACCCCAAGTGGGAGGGGGGAGTTAACAAAATGTTCCACGGGATCCAGGAC TACGAGGAAAACAAGGCCCGGGTGCACCTGGTGATGGAGAAGGGCGACACTGTTTTCTTCCATCCTTTG CTCATCCACGGATCTGGTCAGAATAAAACCCAGGGATTCCGGAAGGCAATTTCCTGCCATTTCGCCAGT GCCGATTGCCACTACATTGACGTGAAGGGCACCAGTCAAGAAAACATCGAGAAGGAAGTTGTAGGAATA GCACATAAATTCTTTGGAGCTGAAAATAGCGTGAACTTGAAGGATATTTGGATGTTTCGAGCTCGACTT GTGAAAGGAGAAAGAACCAATCTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001037537 |
| Insert Size | 717 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001037537.1 |
| RefSeq Size | 1725 bp |
| RefSeq ORF | 717 bp |
| Locus ID | 5264 |
| UniProt ID | O14832 |
| Protein Families | Druggable Genome |
| MW | 27.3 kDa |
| Gene Summary | This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream ATG and result in an isoform (b) with a shorter N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211742 | PHYH (Myc-DDK-tagged)-Human phytanoyl-CoA 2-hydroxylase (PHYH), transcript variant 2 |
CNY 3656.00 |
|
| RC211742L3 | Lenti ORF clone of Human phytanoyl-CoA 2-hydroxylase (PHYH), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211742L4 | Lenti ORF clone of Human phytanoyl-CoA 2-hydroxylase (PHYH), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG211742 | PHYH (tGFP-tagged) - Human phytanoyl-CoA 2-hydroxylase (PHYH), transcript variant 2 |
CNY 5256.00 |
