DYNLL1 (NM_001037495) Human Untagged Clone

CAT#: SC302900

DYNLL1 (untagged)-Human dynein, light chain, LC8-type 1 (DYNLL1), transcript variant 2



  "NM_001037495" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
DYNLL1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DLC1; DLC8; DNCL1; DNCLC1; hdlc1; LC8; LC8a; PIN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302900 representing NM_001037495.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAG
TGCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTT
GACAAGAAGTACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACACATGAA
ACCAAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTTCAAATCTGGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001037495
Insert Size 270 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001037495.1
RefSeq Size 747 bp
RefSeq ORF 270 bp
Locus ID 8655
UniProt ID P63167
MW 10.4 kDa
Gene Summary Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) contains a distinct 5' UTR including an alternate, downstream transcription initiation site. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...