PAR6 (PARD6A) (NM_001037281) Human Untagged Clone
CAT#: SC302873
PARD6A (untagged)-Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PAR-6A; PAR6; PAR6alpha; PAR6C; TAX40; TIP-40 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302873 representing NM_001037281.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCCGGCCGCAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGAC GCCGAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGGTTGCTG CGGGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCTCATGGCGACCTGCTG CCCCTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGGCCCCCGCCACTGCGCCTACTGGTG CAGAAGCGGGAAGCTGACTCCAGCGGCCTGGCTTTTGCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGG CTCTTGCTGCGGCCAGTGGCACCCCTGCGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTC CGCCAGGTTTCCTCAGTCATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAG CATGGTTCAGACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGC CTGGAGCGGGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGTACAGGGCTG CTGGCGGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGGAAGACCTTGGACCAAGTG ACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACTGTCAAGCCCGCCAACCAGCGCAATAAC GTGGTGCGAGGGGCATCTGGGCGTTTGACAGGTCCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGAT AGTGACGATGACAGCAGTGACCTGGTCATTGAGAACCGCCAGCCTCCCAGTTCCAATGGGCTGTCTCAG GGGCCCCCGTGCTGGGACCTGCACCCTGGCTGCCGACATCCTGGTACCCGCAGCTCTCTGCCCTCCCTG GATGACCAGGAGCAGGCCAGTTCTGGCTGGGGGAGTCGCATTCGAGGAGATGGTAGTGGCTTCAGCCTC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001037281 |
| Insert Size | 1038 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001037281.1 |
| RefSeq Size | 1270 bp |
| RefSeq ORF | 1038 bp |
| Locus ID | 50855 |
| UniProt ID | Q9NPB6 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Endocytosis, Tight junction |
| MW | 37.3 kDa |
| Gene Summary | This gene is a member of the PAR6 family and encodes a protein with a PSD95/Discs-large/ZO1 (PDZ) domain and a semi-Cdc42/Rac interactive binding (CRIB) domain. This cell membrane protein is involved in asymmetrical cell division and cell polarization processes as a member of a multi-protein complex. The protein also has a role in the epithelial-to-mesenchymal transition (EMT) that characterizes the invasive phenotype associated with metastatic carcinomas. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a protein (isoform 2) that is one amino acid shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204843 | PARD6A (Myc-DDK-tagged)-Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2 |
CNY 3656.00 |
|
| RC204843L1 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, Myc-DDK-tagged |
CNY 6056.00 |
|
| RC204843L2 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RC204843L3 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC204843L4 | Lenti ORF clone of Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG204843 | PARD6A (tGFP-tagged) - Human par-6 partitioning defective 6 homolog alpha (C. elegans) (PARD6A), transcript variant 2 |
CNY 5256.00 |
