KCNIP1 (NM_001034837) Human Untagged Clone
CAT#: SC302799
KCNIP1 (untagged)-Human Kv channel interacting protein 1 (KCNIP1), transcript variant 1
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KCHIP1; VABP |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001034837 edited
ATGGGGGCCGTCATGGGCACCTTCTCATCTCTGCAAACCAAACAAAGGCGACCCTCGAAA GACATCGCCTGGTGGTATTACCAGTATCAGAGAGATAAGATTGAAGATGAGCTGGAGATG ACCATGGTTTGCCATCGGCCCGAGGGACTGGAGCAGCTCGAGGCCCAGACCAACTTCACC AAGAGGGAGCTGCAGGTCCTTTATCGAGGCTTCAAAAATGAGTGCCCCAGTGGTGTGGTC AACGAAGACACATTCAAGCAGATCTATGCTCAGTTTTTCCCTCATGGAGATGCCAGCACG TATGCCCATTACCTCTTCAATGCCTTCGACACCACTCAGACAGGCTCCGTGAAGTTCGAG GACTTTGTAACCGCTCTGTCGATTTTATTGAGAGGAACTGTCCACGAGAAACTAAGGTGG ACATTTAATTTGTATGACATCAACAAGGACGGATACATAAACAAAGAGGAGATGATGGAC ATTGTCAAAGCCATCTATGACATGATGGGGAAATACACATATCCTGTGCTCAAAGAGGAC ACTCCAAGGCAGCATGTGGACGTCTTCTTCCAGAAAATGGACAAAAATAAAGATGGCATC GTAACTTTAGATGAATTTCTTGAATCATGTCAGGAGGACGACAACATCATGAGGTCTCTC CAGCTGTTTCAAAATGTCATGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001034837 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001034837.1, NP_001030009.1 |
RefSeq Size | 2053 bp |
RefSeq ORF | 684 bp |
Locus ID | 30820 |
UniProt ID | Q9NZI2 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] Transcript Variant: This variant (1, also known as KCNP1-Ib) contains an alternate in-frame exon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 5. It encodes isoform 1 which is shorter than isoform 5. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224442 | KCNIP1 (Myc-DDK-tagged)-Human Kv channel interacting protein 1 (KCNIP1), transcript variant 1 |
CNY 2400.00 |
|
RC224442L3 | Lenti-ORF clone of KCNIP1 (Myc-DDK-tagged)-Human Kv channel interacting protein 1 (KCNIP1), transcript variant 1 |
CNY 5890.00 |
|
RC224442L4 | Lenti-ORF clone of KCNIP1 (mGFP-tagged)-Human Kv channel interacting protein 1 (KCNIP1), transcript variant 1 |
CNY 5890.00 |
|
RG224442 | KCNIP1 (tGFP-tagged) - Human Kv channel interacting protein 1 (KCNIP1), transcript variant 1 |
CNY 4370.00 |