SDF1 (CXCL12) (NM_001033886) Human Untagged Clone
CAT#: SC302777
CXCL12 (untagged)-Human chemokine (C-X-C motif) ligand 12 (CXCL12), transcript variant 3
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IRH; PBSF; SCYB12; SDF1; TLSF; TPAR1 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001033886 edited
ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTGCTGACCGCGCTCTGCCTCAGCGAC GGGAAGCCCGTCAGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAAAGCCATGTTGCC AGAGCCAACGTCAAGCATCTCAAAATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTA GCCCGGCTGAAGAACAACAACAGACAAGTGTGCATTGACCCGAAGCTAAAGTGGATTCAG GAGTACCTGGAGAAAGCTTTAAACAAGGGGCGCAGAGAAGAAAAAGTGGGGAAAAAAGAA AAGATAGGAAAAAAGAAGCGACAGAAGAAGAGAAAGGCTGCCCAGAAAAGGAAAAACTAG |
Restriction Sites | Please inquire |
ACCN | NM_001033886 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033886.1, NP_001029058.1 |
RefSeq Size | 471 bp |
RefSeq ORF | 360 bp |
Locus ID | 6387 |
UniProt ID | P48061 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Axon guidance, Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Leukocyte transendothelial migration |
Gene Summary | This antimicrobial gene encodes a stromal cell-derived alpha chemokine member of the intercrine family. The encoded protein functions as the ligand for the G-protein coupled receptor, chemokine (C-X-C motif) receptor 4, and plays a role in many diverse cellular functions, including embryogenesis, immune surveillance, inflammation response, tissue homeostasis, and tumor growth and metastasis. Mutations in this gene are associated with resistance to human immunodeficiency virus type 1 infections. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (3) contains an alternate exon, and differs in the 3' coding region and UTR compared to variant 1. The resulting protein (isoform gamma) is longer and has a distinct C-terminus compared to isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223855 | CXCL12 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 12 (CXCL12), transcript variant 3 |
CNY 3990.00 |
|
RC223855L3 | Lenti-ORF clone of CXCL12 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 12 (CXCL12), transcript variant 3 |
CNY 5890.00 |
|
RC223855L4 | Lenti-ORF clone of CXCL12 (mGFP-tagged)-Human chemokine (C-X-C motif) ligand 12 (CXCL12), transcript variant 3 |
CNY 5890.00 |
|
RG223855 | CXCL12 (tGFP-tagged) - Human chemokine (C-X-C motif) ligand 12 (CXCL12), transcript variant 3 |
CNY 4370.00 |