PKC zeta (PRKCZ) (NM_001033582) Human Untagged Clone
CAT#: SC302749
PRKCZ (untagged)-Human protein kinase C, zeta (PRKCZ), transcript variant 3
CNY 7220.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PKC-ZETA; PKC2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302749 representing NM_001033582.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATTCTGTCATGCCTTCCCAAGAGCCTCCAGTAGACGACAAGAACGAGGACGCCGACCTTCCTTCC GAGGAGACAGATGGAATTGCTTACATTTCCTCATCCCGGAAGCATGACAGCATTAAAGACGACTCGGAG GACCTTAAGCCAGTTATCGATGGGATGGATGGAATCAAAATCTCTCAGGGGCTTGGGCTGCAGGACTTT GACCTAATCAGAGTCATCGGGCGCGGGAGCTACGCCAAGGTTCTCCTGGTGCGGTTGAAGAAGAATGAC CAAATTTACGCCATGAAAGTGGTGAAGAAAGAGCTGGTGCATGATGACGAGGATATTGACTGGGTACAG ACAGAGAAGCACGTGTTTGAGCAGGCATCCAGCAACCCCTTCCTGGTCGGATTACACTCCTGCTTCCAG ACGACAAGTCGGTTGTTCCTGGTCATTGAGTACGTCAACGGCGGGGACCTGATGTTCCACATGCAGAGG CAGAGGAAGCTCCCTGAGGAGCACGCCAGGTTCTACGCGGCCGAGATCTGCATCGCCCTCAACTTCCTG CACGAGAGGGGGATCATCTACAGGGACCTGAAGCTGGACAACGTCCTCCTGGATGCGGACGGGCACATC AAGCTCACAGACTACGGCATGTGCAAGGAAGGCCTGGGCCCTGGTGACACAACGAGCACTTTCTGCGGA ACCCCGAATTACATCGCCCCCGAAATCCTGCGGGGAGAGGAGTACGGGTTCAGCGTGGACTGGTGGGCG CTGGGAGTCCTCATGTTTGAGATGATGGCCGGGCGCTCCCCGTTCGACATCATCACCGACAACCCGGAC ATGAACACAGAGGACTACCTTTTCCAAGTGATCCTGGAGAAGCCCATCCGGATCCCCCGGTTCCTGTCC GTCAAAGCCTCCCATGTTTTAAAAGGATTTTTAAATAAGGACCCCAAAGAGAGGCTCGGCTGCCGGCCA CAGACTGGATTTTCTGACATCAAGTCCCACGCGTTCTTCCGCAGCATAGACTGGGACTTGCTGGAGAAG AAGCAGGCGCTCCCTCCATTCCAGCCACAGATCACAGACGACTACGGTCTGGACAACTTTGACACACAG TTCACCAGCGAGCCCGTGCAGCTGACCCCAGACGATGAGGATGCCATAAAGAGGATCGACCAGTCAGAG TTCGAAGGCTTTGAGTATATCAACCCATTATTGCTGTCCACCGAGGAGTCGGTGTGA AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT ATCCTGGATTACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-RsrII |
ACCN | NM_001033582 |
Insert Size | 1230 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033582.1 |
RefSeq Size | 2044 bp |
RefSeq ORF | 1230 bp |
Locus ID | 5590 |
UniProt ID | Q05513 |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Chemokine signaling pathway, Endocytosis, Insulin signaling pathway, Tight junction, Type II diabetes mellitus |
MW | 46.6 kDa |
Gene Summary | Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation from a downstream ATG and an isoform (3) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform (2). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Effects on ligand interaction and membrane translocation of the positively charged arginine residues situated along the C1 domain binding cleft in the atypical protein kinase C isoforms
,Yongmei Pu, Megan L. Peach, Susan H. Garfield, Stephen Wincovitch, Victor E. Marquez, and Peter M. Blumberg,
J. Biol. Chem., Vol. 281, Issue 44, 33773-33788, November 3, 2006
[PRKCZ]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215013 | PRKCZ (Myc-DDK-tagged)-Human protein kinase C, zeta (PRKCZ), transcript variant 3 |
CNY 4408.00 |
|
RC215013L3 | Lenti ORF clone of Human protein kinase C, zeta (PRKCZ), transcript variant 3, Myc-DDK-tagged |
CNY 5990.00 |
|
RC215013L4 | Lenti ORF clone of Human protein kinase C, zeta (PRKCZ), transcript variant 3, mGFP tagged |
CNY 5990.00 |
|
RG215013 | PRKCZ (tGFP-tagged) - Human protein kinase C, zeta (PRKCZ), transcript variant 3 |
CNY 4470.00 |
其它PKC zeta产品