PPM1B (NM_001033557) Human Untagged Clone
CAT#: SC302727
PPM1B (untagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 5
CNY 6180.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PP2C-beta; PP2C-beta-X; PP2CB; PP2CBETA; PPC2BETAX |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001033557, the custom clone sequence may differ by one or more nucleotides
ATGGGTGCATTTTTGGATAAACCCAAAACTGAAAAACATAATGCTCATGGTGCTGGGAAT GGTTTACGTTATGGCCTGAGCAGCATGCAAGGATGGAGAGTGGAAATGGAAGATGCACAC ACAGCTGTTGTAGGTATTCCTCACGGCTTGGAAGACTGGTCATTTTTTGCAGTTTATGAT GGTCATGCTGGATCCCGAGTGGCAAATTACTGCTCAACACATTTATTAGAACACATCACT ACTAACGAAGACTTTAGGGCAGCTGGAAAATCAGGATCTGCTCTTGAGCTTTCAGTGGAA AATGTTAAGAATGGTATCAGAACTGGATTTTTGAAAATTGATGAATACATGCGTAACTTT TCAGACCTCAGAAACGGGATGGACAGGAGTGGTTCAACTGCAGTGGGAGTTATGATTTCA CCTAAGCATATCTACTTTATCAACTGTGGTGATTCACGTGCTGTTCTGTATAGGAATGGA CAAGTCTGCTTTTCTACCCAGGATCACAAACCTTGCAATCCAAGGGAAAAGGAGCGAATC CAAAATGCAGGAGGCAGCGTGATGATACAACGTGTTAATGGTTCATTAGCAGTATCTCGT GCTCTGGGGGACTATGATTACAAGTGTGTTGATGGCAAGGGCCCAACAGAACAACTTGTT TCTCCAGAGCCTGAGGTTTATGAAATTTTAAGAGCAGAAGAGGATGAATTTATCATCTTG GCTTGTGATGGGATCTGGGATGTTATGAGTAATGAGGAGCTCTGTGAATATGTTAAATCT AGGCTTGAGGTATCTGATGACCTGGAAAATGTGTGCAATTGGGTAGTGGACACTTGTTTA CACAAGGGAAGTCGAGATAACATGAGTATTGTACTAGTTTGCTTTTCAAATGCTCCCAAG GTCTCAGATGAAGCGGTGAAAAAAGATTCAGAGTTGGATAAGCACTTGGAATCACGGGTT GAAGAGATTATGGAGAAGTCTGGCGAGGAAGGAATGCCTGATCTTGCCCATGTCATGCGC ATCTTGTCTGCAGAAAATATCCCAAATTTGCCTCCTGGGGGAGGTCTTGCTGGCAAGCGT AATGTTATTGAAGCTGTTTATAGTAGACTGAATCCACATAGAGAAAGTGATGGGCAGAAA TGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001033557 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001033557.1, NP_001028729.1 |
| RefSeq Size | 3056 bp |
| RefSeq ORF | 1143 bp |
| Locus ID | 5495 |
| UniProt ID | O75688 |
| Protein Families | Druggable Genome, Phosphatase, Stem cell - Pluripotency |
| Protein Pathways | MAPK signaling pathway |
| Gene Summary | The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase has been shown to dephosphorylate cyclin-dependent kinases (CDKs), and thus may be involved in cell cycle control. Overexpression of this phosphatase is reported to cause cell-growth arrest or cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. Additional transcript variants have been described, but currently do not represent full-length sequences. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) contains an alternate 3' terminal exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (5) has a distinct C-terminus and is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215704 | PPM1B (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 5 |
CNY 3656.00 |
|
| RC215704L3 | Lenti-ORF clone of PPM1B (Myc-DDK-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 5 |
CNY 5890.00 |
|
| RC215704L4 | Lenti-ORF clone of PPM1B (mGFP-tagged)-Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 5 |
CNY 5890.00 |
|
| RG215704 | PPM1B (tGFP-tagged) - Human protein phosphatase, Mg2+/Mn2+ dependent, 1B (PPM1B), transcript variant 5 |
CNY 4370.00 |
