RAB41 (NM_001032726) Human Untagged Clone
CAT＃: SC302663
RAB41 (untagged)-Human RAB41, member RAS oncogene family (RAB41)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001032726 edited
CAGGCTGAGCGTTGGAAGCCATTTTGGCTGCAGCCTACCTGAAGCGATGTCTGCCTTTGG TCACGACGAGGCCTGGATGGAGGCCGGAGGCTTTGGTCTGGAGGCTGCCGAAAGAACGGA ATACCAGTCTCTGTGCAAATCTAAACTCTTATTCCTGGGAGAGCAGAGCGGGAAGACATC CATCATCAGCCGCTTCATGTACAACAGCTTCGGCTGCGCCTGCCAGGCAACTGTTGGAAT TGACTTCTTGTCTAAGACCATGTACTTGGAGGACCAAATAGTTCAGCTGCAGCTATGGGA CACAGCTGGCCAGGAGCGCTTTCACAGCCTAATTCCTAGCTACATTCGTGATTCAACTAT TGCAGTGGTTGTCTATGACATTACAAACATCAATTCTTTTAAGGAGACAGATAAGTGGGT AGAACACGTGCGAGCAGAAAGAGGTGACGATGTTGTCATCATGTTGTTGGGTAACAAGAT TGATTTGGATAACAAAAGACAAGTCACTGCAGAACAGGGTGAAGAAAAATCCAGAAACCT CAATGTGATGTTTATTGAGACCAGTGCCAAAACCGGTTACAACGTGAAAAAGCTGTTCCG GCGTGTGGCTTCTGCCCTTCTTTCCACAAGGACTTCACCTCCACCAAAAGAGGGGACGGT TGAAATCGAACTGGAATCCTTCGAGGAGTCAGGCAACAGAAGCTATTGTTGACAGCTTAG GCTTTCTCTGCCTCATTTGATGGATTTCTTACATTTGGGCTTGCCATACCAGTTCTCCTC CCCACCTCG |
| Restriction Sites | Please inquire |
| ACCN | NM_001032726 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to differ from the protein associated to this reference by a single amino acid. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001032726.1, NP_001027898.1 |
| RefSeq Size | 1028 bp |
| RefSeq ORF | 669 bp |
| Locus ID | 347517 |
| UniProt ID | Q5JT25 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a small GTP-binding protein that belongs to the largest family within the Ras superfamily. These proteins function as regulators of membrane trafficking. They cycle between inactive GDP-bound and activated GTP-bound states, which is controlled by GTP hydrolysis-activating proteins (GAPs). This family member can be activated by the GAP protein RN-Tre, and it is localized to the Golgi complex. [provided by RefSeq, May 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214913 | RAB41 (Myc-DDK-tagged)-Human RAB41, member RAS oncogene family (RAB41) |
CNY 6192.00 |
|
| RC214913L3 | Lenti ORF clone of Human RAB41, member RAS oncogene family (RAB41), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214913L4 | Lenti ORF clone of Human RAB41, member RAS oncogene family (RAB41), mGFP tagged |
CNY 5890.00 |
|
| RG214913 | RAB41 (tGFP-tagged) - Human RAB41, member RAS oncogene family (RAB41) |
CNY 7792.00 |
