HHLA3 (NM_001031693) Human Untagged Clone
CAT#: SC302539
HHLA3 (untagged)-Human HERV-H LTR-associating 3 (HHLA3), transcript variant 1
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HERV-H LTR-associating 3; human endogenous retrovirus-H long terminal repeat-associating 3; OTTHUMP00000010943 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302539 representing NM_001031693.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCGGTGCATGTTATAAACAACCACTTAAACCCTCCGGATCTGAGCCTCCCGCAGAGGAATGCAGA ATGACGCCACGGCACGCAGGATGTGATGTCACCGAGATGCAGAGGATACTCAGTCAACCAACATTTACT GAGCATCTACTTCGTGCCGTATGTCTTGTCAACGGAAAGGGGTCCCTATCCAGACCCCAAGAGAGCATT CTTGGATCTCTTGCAAGAAAGAATTTGAGGCGAATCCATAGAGTAAGCTTAGTGATGTGTGTCAGACCT CTGAGCCCAAGCAAAGCCATCATATCCCCTGTGACCTGCATGTATACATCCAGATGGCCTGAAGCAAGT GAAGAATCACAAAAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001031693 |
Insert Size | 366 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001031693.2 |
RefSeq Size | 818 bp |
RefSeq ORF | 366 bp |
Locus ID | 11147 |
UniProt ID | Q9XRX5 |
MW | 13.5 kDa |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213042 | HHLA3 (Myc-DDK-tagged)-Human HERV-H LTR-associating 3 (HHLA3), transcript variant 1 |
CNY 1200.00 |
|
RC213042L3 | Lenti ORF clone of Human HERV-H LTR-associating 3 (HHLA3), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC213042L4 | Lenti ORF clone of Human HERV-H LTR-associating 3 (HHLA3), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG213042 | HHLA3 (tGFP-tagged) - Human HERV-H LTR-associating 3 (HHLA3), transcript variant 1 |
CNY 2800.00 |