COX19 (NM_001031617) Human Untagged Clone
CAT#: SC302518
COX19 (untagged)-Human COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX19)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302518 representing NM_001031617.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGACCGCCATGAATTTCGGGACCAAGAGCTTCCAGCCGCGGCCCCCGGACAAGGGCAGCTTCCCG CTGGATCACTTAGGTGAATGTAAAAGCTTTAAAGAGAAATTCATGAAGTGTCTTCATAACAATAATTTT GAAAATGCTTTGTGCAGAAAGGAATCAAAAGAATATTTAGAATGCAGGATGGAGAGAAAATTGATGCTA CAAGAACCATTGGAGAAACTGGGATTTGGAGACTTGACTAGTGGAAAATCAGAGGCAAAAAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001031617 |
| Insert Size | 273 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001031617.2 |
| RefSeq Size | 4896 bp |
| RefSeq ORF | 273 bp |
| Locus ID | 90639 |
| UniProt ID | Q49B96 |
| MW | 10.4 kDa |
| Gene Summary | COX19 encodes a cytochrome c oxidase (COX)-assembly protein. The S. cerevisiae Cox19 protein may play a role in metal transport to the mitochondrial intermembrane space and assembly of complex IV of the mitochondrial respiratory chain (Sacconi et al., 2005 [PubMed 16212937]).[supplied by OMIM, Mar 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210770 | COX19 (Myc-DDK-tagged)-Human COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX19) |
CNY 1200.00 |
|
| RC210770L3 | Lenti ORF clone of Human COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX19), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC210770L4 | Lenti ORF clone of Human COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX19), mGFP tagged |
CNY 5890.00 |
|
| RG210770 | COX19 (tGFP-tagged) - Human COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX19) |
CNY 2800.00 |

