APRT (NM_001030018) Human Untagged Clone
CAT＃: SC302495
APRT (untagged)-Human adenine phosphoribosyltransferase (APRT), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AMP; APRTD |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302495 representing NM_001030018.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGACTCCGAGCTGCAGCTGGTTGAGCAGCGGATCCGCAGCTTCCCCGACTTCCCCACCCCAGGC GTGGTATTCAGGGACATCTCGCCCGTCCTGAAGGACCCCGCCTCCTTCCGCGCCGCCATCGGCCTCCTG GCGCGACACCTGAAGGCGACCCACGGGGGCCGCATCGACTACATCGCAGGCCTAGACTCCCGAGGCTTC CTCTTTGGCCCCTCCCTGGCCCAGGAGCTTGGACTGGGCTGCGTGCTCATCCGAAAGCGGGGGAAGCTG CCAGGCCCCACTCTGTGGGCCTCCTATTCCCTGGAGTACGGGAAGGCTGAGCTGGAGATTCAGAAAGAC GCCCTGGAGCCAGGACAGAGGGTGGTCGTCGTGGATGATCTGCTGGCCACTGGTGTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001030018 |
| Insert Size | 405 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001030018.1 |
| RefSeq Size | 673 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 353 |
| UniProt ID | P07741 |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways, Purine metabolism |
| MW | 14.6 kDa |
| Gene Summary | Adenine phosphoribosyltransferase belongs to the purine/pyrimidine phosphoribosyltransferase family. A conserved feature of this gene is the distribution of CpG dinucleotides. This enzyme catalyzes the formation of AMP and inorganic pyrophosphate from adenine and 5-phosphoribosyl-1-pyrophosphate (PRPP). It also produces adenine as a by-product of the polyamine biosynthesis pathway. A homozygous deficiency in this enzyme causes 2,8-dihydroxyadenine urolithiasis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate segment compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222337 | APRT (Myc-DDK-tagged)-Human adenine phosphoribosyltransferase (APRT), transcript variant 2 |
CNY 1200.00 |
|
| RC222337L3 | Lenti ORF clone of Human adenine phosphoribosyltransferase (APRT), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC222337L4 | Lenti ORF clone of Human adenine phosphoribosyltransferase (APRT), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG222337 | APRT (tGFP-tagged) - Human adenine phosphoribosyltransferase (APRT), transcript variant 2 |
CNY 4370.00 |
