United States
Germany
Japan
United Kingdom
China
PCLAF (NM_001029989) Human Untagged Clone
CAT＃: SC302476
KIAA0101 (untagged)-Human KIAA0101 (KIAA0101), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | KIAA0101; L5; NS5ATP9; OEATC; OEATC-1; OEATC1; p15(PAF); p15/PAF; p15PAF; PAF; PAF15 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001029989, the custom clone sequence may differ by one or more nucleotides
ATGGTGCGGACTAAAGCAGACAGTGTTCCAGGCACTTACAGAAAAGTGGTGGCTGCTCGA GCCCCCAGAAAGGTGCTTGGTTCTTCCACCTCTGCCACTAATTCGACATCAGTTTCATCG AGGAAAGAGCATGTCCTTTGCAACCTGATCACACAAATGATGAAAAAGAATAGAACTTTC TCATTCATCTTTGAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001029989 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001029989.1, NP_001025160.1 |
| RefSeq Size | 1345 bp |
| RefSeq ORF | 198 bp |
| Locus ID | 9768 |
| UniProt ID | Q15004 |
| Protein Families | Druggable Genome |
| Gene Summary | PCNA-binding protein that acts as a regulator of DNA repair during DNA replication. Following DNA damage, the interaction with PCNA is disrupted, facilitating the interaction between monoubiquitinated PCNA and the translesion DNA synthesis DNA polymerase eta (POLH) at stalled replisomes, facilitating the bypass of replication-fork-blocking lesions. Also acts as a regulator of centrosome number.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an exon in the central coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216104 | KIAA0101 (Myc-DDK-tagged)-Human KIAA0101 (KIAA0101), transcript variant 2 |
CNY 3,990.00 |
|
| RC216104L3 | Lenti-ORF clone of KIAA0101 (Myc-DDK-tagged)-Human KIAA0101 (KIAA0101), transcript variant 2 |
CNY 5,890.00 |
|
| RC216104L4 | Lenti-ORF clone of KIAA0101 (mGFP-tagged)-Human KIAA0101 (KIAA0101), transcript variant 2 |
CNY 5,890.00 |
|
| RG216104 | KIAA0101 (tGFP-tagged) - Human KIAA0101 (KIAA0101), transcript variant 2 |
CNY 4,370.00 |
