RGS7BP (NM_001029875) Human Untagged Clone
CAT＃: SC302455
RGS7BP (untagged)-Human regulator of G-protein signaling 7 binding protein (RGS7BP)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | R7BP |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001029875 edited
ATGAGTTCTGCACCGAATGGGCGCAAAAAGCGCCCCAGCCGGTCCACCCGCTCCTCGATC TTCCAGATCAGCAAGCCCCCGCTGCAGAGCGGAGATTGGGAGCGCAGGGGCAGCGGCTCC GAGAGCGCCCACAAAACCCAACGAGCCCTGGACGACTGCAAGATGCTTGTCCAAGAGTTC AACACACAAGTGGCCCTGTACCGAGAGCTGGTCATTTCTATTGGGGATGTCTCGGTCAGC TGCCCCTCACTCCGGGCGGAAATGCACAAGACAAGAACCAAAGGCTGTGAAATGGCCCGT CAGGCACACCAAAAATTGGCTGCCATCTCAGGCCCGGAAGATGGTGAGATCCATCCAGAA ATCTGTCGGCTTTACATCCAGCTGCAGTGCTGCTTAGAAATGTATACCACAGAGATGCTA AAATCCATATGTCTGCTGGGGTCTCTTCAGTTTCATCGAAAAGGAAAGGAACCTGGCGGG GGAACCAAGAGTTTGGATTGCAAAATTGAGGAGAGTGCTGAAACACCTGCCCTAGAAGAC TCCTCATCATCCCCCGTAGATAGTCAGCAACATTCCTGGCAGGTTTCCACAGACATTGAG AACACTGAAAGAGACATGAGAGAAATGAAAAACCTTTTAAGCAAACTCAGGGAAACTATG CCTTTACCATTGAAAAATCAAGATGACAGCAGCCTTCTGAATCTAACTCCCTACCCCCTG GTGAGAAGACGGAAGAGAAGGTTCTTTGGGCTGTGTTGTCTCATCTCAAGCTAG |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001029875 |
| Insert Size | 3800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | ORF matches with that of NM_001029875.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001029875.1, NP_001025046.1 |
| RefSeq Size | 3821 bp |
| RefSeq ORF | 774 bp |
| Locus ID | 401190 |
| UniProt ID | Q6MZT1 |
| Gene Summary | This gene encodes a protein that binds to all members of the R7 subfamily of regulators of G protein signaling and regulates their translocation between the nucleus and the plasma membrane. The encoded protein could be regulated by reversible palmitoylation, which anchors it to the plasma membrane. Depalmitoylation localizes the protein to the nucleus. Polymorphisms in this gene may be associated with risk of aspirin-exacerbated respiratory disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214899 | RGS7BP (Myc-DDK-tagged)-Human regulator of G-protein signaling 7 binding protein (RGS7BP) |
CNY 2400.00 |
|
| RC214899L1 | Lenti ORF clone of Human regulator of G-protein signaling 7 binding protein (RGS7BP), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC214899L2 | Lenti ORF clone of Human regulator of G-protein signaling 7 binding protein (RGS7BP), mGFP tagged |
CNY 5890.00 |
|
| RC214899L3 | Lenti ORF clone of Human regulator of G-protein signaling 7 binding protein (RGS7BP), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214899L4 | Lenti ORF clone of Human regulator of G-protein signaling 7 binding protein (RGS7BP), mGFP tagged |
CNY 5890.00 |
|
| RG214899 | RGS7BP (tGFP-tagged) - Human regulator of G-protein signaling 7 binding protein (RGS7BP) |
CNY 4370.00 |
